Multiple sequence alignment - TraesCS4B01G394100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G394100 chr4B 100.000 2303 0 0 1 2303 668228749 668231051 0 4253
1 TraesCS4B01G394100 chr4B 97.225 2306 57 6 1 2303 669484884 669487185 0 3897
2 TraesCS4B01G394100 chr4B 97.182 2307 56 7 1 2303 668906604 668908905 0 3892
3 TraesCS4B01G394100 chr4B 97.102 2312 52 7 1 2303 668464701 668467006 0 3884
4 TraesCS4B01G394100 chr4B 96.921 2306 58 9 1 2303 668525822 668528117 0 3853
5 TraesCS4B01G394100 chr4B 95.776 2320 49 18 1 2303 668623665 668625952 0 3696
6 TraesCS4B01G394100 chr4B 95.521 2322 52 21 1 2303 669588520 669590808 0 3664
7 TraesCS4B01G394100 chr4B 97.914 1534 28 4 772 2303 669142067 669140536 0 2652
8 TraesCS4B01G394100 chr4B 97.715 1532 32 3 772 2302 668992011 668993540 0 2632
9 TraesCS4B01G394100 chr4B 97.262 1534 36 5 772 2303 669303507 669301978 0 2595
10 TraesCS4B01G394100 chr4B 96.917 1200 29 6 1107 2303 668398706 668399900 0 2004
11 TraesCS4B01G394100 chr4B 98.361 549 9 0 1 549 668374318 668374866 0 965
12 TraesCS4B01G394100 chr5A 97.752 1468 30 2 1 1468 707877713 707879177 0 2525
13 TraesCS4B01G394100 chr5A 96.791 779 17 7 1529 2303 707879177 707879951 0 1293
14 TraesCS4B01G394100 chr7B 95.286 594 28 0 1 594 336367701 336368294 0 942


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G394100 chr4B 668228749 668231051 2302 False 4253 4253 100.0000 1 2303 1 chr4B.!!$F1 2302
1 TraesCS4B01G394100 chr4B 669484884 669487185 2301 False 3897 3897 97.2250 1 2303 1 chr4B.!!$F9 2302
2 TraesCS4B01G394100 chr4B 668906604 668908905 2301 False 3892 3892 97.1820 1 2303 1 chr4B.!!$F7 2302
3 TraesCS4B01G394100 chr4B 668464701 668467006 2305 False 3884 3884 97.1020 1 2303 1 chr4B.!!$F4 2302
4 TraesCS4B01G394100 chr4B 668525822 668528117 2295 False 3853 3853 96.9210 1 2303 1 chr4B.!!$F5 2302
5 TraesCS4B01G394100 chr4B 668623665 668625952 2287 False 3696 3696 95.7760 1 2303 1 chr4B.!!$F6 2302
6 TraesCS4B01G394100 chr4B 669588520 669590808 2288 False 3664 3664 95.5210 1 2303 1 chr4B.!!$F10 2302
7 TraesCS4B01G394100 chr4B 669140536 669142067 1531 True 2652 2652 97.9140 772 2303 1 chr4B.!!$R1 1531
8 TraesCS4B01G394100 chr4B 668992011 668993540 1529 False 2632 2632 97.7150 772 2302 1 chr4B.!!$F8 1530
9 TraesCS4B01G394100 chr4B 669301978 669303507 1529 True 2595 2595 97.2620 772 2303 1 chr4B.!!$R2 1531
10 TraesCS4B01G394100 chr4B 668398706 668399900 1194 False 2004 2004 96.9170 1107 2303 1 chr4B.!!$F3 1196
11 TraesCS4B01G394100 chr4B 668374318 668374866 548 False 965 965 98.3610 1 549 1 chr4B.!!$F2 548
12 TraesCS4B01G394100 chr5A 707877713 707879951 2238 False 1909 2525 97.2715 1 2303 2 chr5A.!!$F1 2302
13 TraesCS4B01G394100 chr7B 336367701 336368294 593 False 942 942 95.2860 1 594 1 chr7B.!!$F1 593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
576 577 1.055849 TGCTCTGCCAAGTGTAGGAA 58.944 50.0 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1407 1426 1.1862 TCATACAGCAGGCGAGAAGT 58.814 50.0 0.0 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 3.751698 GCGTGTAAGGTTCTCCAAAGAAT 59.248 43.478 0.00 0.00 43.26 2.40
341 342 2.854522 GGACCCGTTCCACATCAAG 58.145 57.895 0.00 0.00 45.10 3.02
576 577 1.055849 TGCTCTGCCAAGTGTAGGAA 58.944 50.000 0.00 0.00 0.00 3.36
764 774 4.034510 GGTATGTGCTTTAGCTGCTAACTG 59.965 45.833 20.95 16.81 42.66 3.16
1241 1251 6.978659 TCGCTTTGTAATGAGTGGTTAGATAG 59.021 38.462 0.00 0.00 0.00 2.08
1373 1388 6.610075 AATGGCATGTCATTCTTACCTTTT 57.390 33.333 19.74 0.00 32.42 2.27
1374 1389 6.610075 ATGGCATGTCATTCTTACCTTTTT 57.390 33.333 7.07 0.00 0.00 1.94
1407 1426 9.890629 AGAAAAGCATGTCATCTTTACTATGTA 57.109 29.630 9.33 0.00 32.72 2.29
1491 1510 0.537371 CCGGGTTCCTGCAGAGTTTT 60.537 55.000 17.39 0.00 0.00 2.43
1719 1740 7.581213 TGTCATGTACATTTTTCTGAAAGGT 57.419 32.000 5.37 6.25 31.43 3.50
1781 1815 8.246180 ACACATCTTGAACATTTGTCCATATTC 58.754 33.333 0.00 0.00 0.00 1.75
1858 1893 7.706159 TGCTGCATTTGGTCTATATTAGTTTG 58.294 34.615 0.00 0.00 0.00 2.93
2042 2080 2.222999 GCGAATGAAGAAGCAGAGAAGC 60.223 50.000 0.00 0.00 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
10 11 3.181445 TGTCCTGCATGTAAACAAGGAGT 60.181 43.478 6.19 0.0 32.33 3.85
239 240 7.881142 ACATGGAATTTTTACAGTGAAATCGA 58.119 30.769 0.00 0.0 0.00 3.59
341 342 2.982744 GAGCAAACCTTCTGGCCGC 61.983 63.158 0.00 0.0 36.63 6.53
1407 1426 1.186200 TCATACAGCAGGCGAGAAGT 58.814 50.000 0.00 0.0 0.00 3.01
2042 2080 2.356818 TTTGGCCGGCCTTCGTTTTG 62.357 55.000 43.34 0.0 37.11 2.44
2232 2276 5.048504 TCTGCTTCTTCATTCGCTCATTTTT 60.049 36.000 0.00 0.0 0.00 1.94
2236 2280 3.118847 TCTCTGCTTCTTCATTCGCTCAT 60.119 43.478 0.00 0.0 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.