Multiple sequence alignment - TraesCS4B01G389000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G389000 chr4B 100.000 3213 0 0 1 3213 665900016 665903228 0.000000e+00 5934
1 TraesCS4B01G389000 chr4B 96.057 3069 86 19 167 3213 629907328 629910383 0.000000e+00 4964
2 TraesCS4B01G389000 chr3B 96.709 3069 65 10 167 3213 452563153 452560099 0.000000e+00 5075
3 TraesCS4B01G389000 chr3B 96.017 3088 85 10 150 3213 73031264 73034337 0.000000e+00 4987
4 TraesCS4B01G389000 chr1A 96.158 3071 87 8 168 3212 444169075 444166010 0.000000e+00 4988
5 TraesCS4B01G389000 chr2B 95.930 3071 92 16 166 3213 553880195 553883255 0.000000e+00 4948
6 TraesCS4B01G389000 chr4A 95.799 3071 100 8 168 3213 36004230 36001164 0.000000e+00 4929
7 TraesCS4B01G389000 chr5A 98.487 2115 28 3 1 2114 705867744 705869855 0.000000e+00 3725
8 TraesCS4B01G389000 chr5A 98.641 1104 14 1 2110 3213 705883335 705884437 0.000000e+00 1954
9 TraesCS4B01G389000 chr5A 97.327 1085 29 0 1132 2216 262471612 262470528 0.000000e+00 1844
10 TraesCS4B01G389000 chr5A 94.987 379 15 4 166 540 310728837 310728459 2.760000e-165 592
11 TraesCS4B01G389000 chr5A 95.210 334 12 2 509 841 310728443 310728113 2.840000e-145 525
12 TraesCS4B01G389000 chr2A 96.866 1085 34 0 1132 2216 694743563 694742479 0.000000e+00 1816
13 TraesCS4B01G389000 chr2A 94.718 284 13 2 850 1132 694743887 694743605 1.060000e-119 440
14 TraesCS4B01G389000 chr5D 97.566 986 23 1 2228 3213 309068222 309067238 0.000000e+00 1687
15 TraesCS4B01G389000 chr6D 97.465 986 23 2 2228 3213 75301816 75300833 0.000000e+00 1681
16 TraesCS4B01G389000 chr7A 91.702 699 32 11 168 841 699627689 699626992 0.000000e+00 946
17 TraesCS4B01G389000 chr7A 94.755 286 13 2 848 1132 709138064 709137780 8.180000e-121 444
18 TraesCS4B01G389000 chr7B 87.334 679 45 19 167 841 720466062 720465421 0.000000e+00 739
19 TraesCS4B01G389000 chr3A 98.817 169 2 0 1 169 200819484 200819652 5.210000e-78 302
20 TraesCS4B01G389000 chr1D 94.012 167 10 0 1 167 156056462 156056296 1.480000e-63 254
21 TraesCS4B01G389000 chr5B 93.413 167 8 2 1 167 639210446 639210283 8.900000e-61 244
22 TraesCS4B01G389000 chr1B 92.216 167 13 0 1 167 14744748 14744582 1.490000e-58 237


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G389000 chr4B 665900016 665903228 3212 False 5934.0 5934 100.0000 1 3213 1 chr4B.!!$F2 3212
1 TraesCS4B01G389000 chr4B 629907328 629910383 3055 False 4964.0 4964 96.0570 167 3213 1 chr4B.!!$F1 3046
2 TraesCS4B01G389000 chr3B 452560099 452563153 3054 True 5075.0 5075 96.7090 167 3213 1 chr3B.!!$R1 3046
3 TraesCS4B01G389000 chr3B 73031264 73034337 3073 False 4987.0 4987 96.0170 150 3213 1 chr3B.!!$F1 3063
4 TraesCS4B01G389000 chr1A 444166010 444169075 3065 True 4988.0 4988 96.1580 168 3212 1 chr1A.!!$R1 3044
5 TraesCS4B01G389000 chr2B 553880195 553883255 3060 False 4948.0 4948 95.9300 166 3213 1 chr2B.!!$F1 3047
6 TraesCS4B01G389000 chr4A 36001164 36004230 3066 True 4929.0 4929 95.7990 168 3213 1 chr4A.!!$R1 3045
7 TraesCS4B01G389000 chr5A 705867744 705869855 2111 False 3725.0 3725 98.4870 1 2114 1 chr5A.!!$F1 2113
8 TraesCS4B01G389000 chr5A 705883335 705884437 1102 False 1954.0 1954 98.6410 2110 3213 1 chr5A.!!$F2 1103
9 TraesCS4B01G389000 chr5A 262470528 262471612 1084 True 1844.0 1844 97.3270 1132 2216 1 chr5A.!!$R1 1084
10 TraesCS4B01G389000 chr5A 310728113 310728837 724 True 558.5 592 95.0985 166 841 2 chr5A.!!$R2 675
11 TraesCS4B01G389000 chr2A 694742479 694743887 1408 True 1128.0 1816 95.7920 850 2216 2 chr2A.!!$R1 1366
12 TraesCS4B01G389000 chr5D 309067238 309068222 984 True 1687.0 1687 97.5660 2228 3213 1 chr5D.!!$R1 985
13 TraesCS4B01G389000 chr6D 75300833 75301816 983 True 1681.0 1681 97.4650 2228 3213 1 chr6D.!!$R1 985
14 TraesCS4B01G389000 chr7A 699626992 699627689 697 True 946.0 946 91.7020 168 841 1 chr7A.!!$R1 673
15 TraesCS4B01G389000 chr7B 720465421 720466062 641 True 739.0 739 87.3340 167 841 1 chr7B.!!$R1 674

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
803 866 0.250209 GCATCGACCTCATCCAGCAT 60.25 55.0 0.0 0.0 0.0 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2508 2615 5.705441 CCAAACAGATTGAGTACTTTGCCTA 59.295 40.0 0.0 0.0 41.85 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 1.736126 CCTGCACTTGTACTGCATCTG 59.264 52.381 8.54 0.0 43.61 2.90
122 123 1.073199 CCAGACCACCAACCTCCAC 59.927 63.158 0.00 0.0 0.00 4.02
707 770 4.698625 AACCCCTCGGACGCCTCT 62.699 66.667 0.00 0.0 0.00 3.69
803 866 0.250209 GCATCGACCTCATCCAGCAT 60.250 55.000 0.00 0.0 0.00 3.79
865 929 2.474816 GTCGTGTGCTCTTGTCTCTTT 58.525 47.619 0.00 0.0 0.00 2.52
959 1023 2.095567 CGAGAGGTTGATGCCTTTGTTG 60.096 50.000 0.00 0.0 39.34 3.33
961 1025 0.681175 AGGTTGATGCCTTTGTTGCC 59.319 50.000 0.00 0.0 34.71 4.52
1988 2094 2.985311 TGGGAAAAAGGAAAATGCCCAT 59.015 40.909 0.00 0.0 39.07 4.00
2152 2259 0.469144 ATCTTTTGTGGTGGGGCGTT 60.469 50.000 0.00 0.0 0.00 4.84
2434 2541 1.136305 CCTTTCTATCGACGCAAGGGA 59.864 52.381 6.97 0.0 46.39 4.20
2508 2615 3.573695 AGGCGGGACAAGTATGTATACT 58.426 45.455 4.17 0.0 45.04 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
55 56 3.454082 AGAGGGAATGAGATGGTGAAGAC 59.546 47.826 0.00 0.00 0.00 3.01
122 123 2.202797 CGGATGCGTCCCACTCTG 60.203 66.667 19.51 0.00 41.83 3.35
707 770 1.031571 GCAATGGATCCACGAAGGCA 61.032 55.000 18.99 0.00 37.29 4.75
1052 1116 0.645355 CAATCCGACGAACATGACGG 59.355 55.000 17.43 14.29 46.23 4.79
1148 1254 8.272889 TGTAGATGGTCTAGAAGTACTACACAT 58.727 37.037 18.50 0.00 35.61 3.21
2508 2615 5.705441 CCAAACAGATTGAGTACTTTGCCTA 59.295 40.000 0.00 0.00 41.85 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.