Multiple sequence alignment - TraesCS4B01G388600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G388600 chr4B 100.000 3768 0 0 1 3768 665811879 665815646 0.000000e+00 6959.0
1 TraesCS4B01G388600 chr5A 98.914 3775 29 6 1 3768 705773825 705777594 0.000000e+00 6734.0
2 TraesCS4B01G388600 chrUn 92.756 3520 196 28 270 3768 108394034 108390553 0.000000e+00 5033.0
3 TraesCS4B01G388600 chrUn 100.000 145 0 0 3624 3768 477845162 477845018 6.200000e-68 268.0
4 TraesCS4B01G388600 chrUn 82.955 88 11 4 409 494 129541909 129541994 4.040000e-10 76.8
5 TraesCS4B01G388600 chrUn 86.765 68 9 0 409 476 183138186 183138119 4.040000e-10 76.8
6 TraesCS4B01G388600 chrUn 86.765 68 9 0 409 476 183187856 183187789 4.040000e-10 76.8
7 TraesCS4B01G388600 chr2D 84.516 620 96 0 2128 2747 10799311 10798692 6.920000e-172 614.0
8 TraesCS4B01G388600 chr2D 88.158 76 9 0 409 484 645843088 645843163 1.440000e-14 91.6
9 TraesCS4B01G388600 chr2D 97.222 36 1 0 382 417 643040953 643040988 1.130000e-05 62.1
10 TraesCS4B01G388600 chr2D 100.000 28 0 0 3126 3153 54074112 54074085 7.000000e-03 52.8
11 TraesCS4B01G388600 chr2B 84.355 620 97 0 2128 2747 15118579 15117960 3.220000e-170 608.0
12 TraesCS4B01G388600 chr2B 84.194 620 98 0 2128 2747 15817371 15816752 1.500000e-168 603.0
13 TraesCS4B01G388600 chr2B 84.032 620 99 0 2128 2747 15694065 15693446 6.970000e-167 597.0
14 TraesCS4B01G388600 chr2B 83.923 622 96 3 2128 2747 15916342 15915723 3.240000e-165 592.0
15 TraesCS4B01G388600 chr2B 83.736 621 99 2 2128 2747 15637478 15636859 1.510000e-163 586.0
16 TraesCS4B01G388600 chr2B 86.765 68 9 0 409 476 10025444 10025377 4.040000e-10 76.8
17 TraesCS4B01G388600 chr2B 81.319 91 13 2 281 369 643687539 643687451 1.880000e-08 71.3
18 TraesCS4B01G388600 chr2A 84.109 623 93 6 2128 2747 11308693 11308074 6.970000e-167 597.0
19 TraesCS4B01G388600 chr2A 86.869 99 13 0 409 507 728559615 728559713 1.110000e-20 111.0
20 TraesCS4B01G388600 chr2A 84.091 88 14 0 409 496 771543480 771543567 6.710000e-13 86.1
21 TraesCS4B01G388600 chr2A 83.516 91 13 2 268 357 657447409 657447498 2.410000e-12 84.2
22 TraesCS4B01G388600 chr4D 82.963 135 20 3 279 412 57471208 57471340 6.610000e-23 119.0
23 TraesCS4B01G388600 chr1D 80.142 141 26 2 269 409 485502498 485502636 1.850000e-18 104.0
24 TraesCS4B01G388600 chr1D 79.000 100 17 4 315 410 30690069 30689970 8.740000e-07 65.8
25 TraesCS4B01G388600 chr7D 79.412 136 28 0 274 409 180412117 180412252 3.100000e-16 97.1
26 TraesCS4B01G388600 chr7A 82.955 88 13 2 270 356 661297637 661297723 1.120000e-10 78.7
27 TraesCS4B01G388600 chr7B 78.704 108 19 3 303 409 252169736 252169632 6.750000e-08 69.4
28 TraesCS4B01G388600 chr7B 89.583 48 3 2 377 423 170369245 170369199 4.060000e-05 60.2
29 TraesCS4B01G388600 chr1B 81.818 77 12 2 409 484 278933281 278933356 3.140000e-06 63.9
30 TraesCS4B01G388600 chr3A 87.755 49 3 2 368 413 40187234 40187282 2.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G388600 chr4B 665811879 665815646 3767 False 6959 6959 100.000 1 3768 1 chr4B.!!$F1 3767
1 TraesCS4B01G388600 chr5A 705773825 705777594 3769 False 6734 6734 98.914 1 3768 1 chr5A.!!$F1 3767
2 TraesCS4B01G388600 chrUn 108390553 108394034 3481 True 5033 5033 92.756 270 3768 1 chrUn.!!$R1 3498
3 TraesCS4B01G388600 chr2D 10798692 10799311 619 True 614 614 84.516 2128 2747 1 chr2D.!!$R1 619
4 TraesCS4B01G388600 chr2B 15117960 15118579 619 True 608 608 84.355 2128 2747 1 chr2B.!!$R2 619
5 TraesCS4B01G388600 chr2B 15816752 15817371 619 True 603 603 84.194 2128 2747 1 chr2B.!!$R5 619
6 TraesCS4B01G388600 chr2B 15693446 15694065 619 True 597 597 84.032 2128 2747 1 chr2B.!!$R4 619
7 TraesCS4B01G388600 chr2B 15915723 15916342 619 True 592 592 83.923 2128 2747 1 chr2B.!!$R6 619
8 TraesCS4B01G388600 chr2B 15636859 15637478 619 True 586 586 83.736 2128 2747 1 chr2B.!!$R3 619
9 TraesCS4B01G388600 chr2A 11308074 11308693 619 True 597 597 84.109 2128 2747 1 chr2A.!!$R1 619

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
864 880 1.388547 GAAGGTTGGCCATATTCGCA 58.611 50.0 6.09 0.0 37.19 5.10 F
1530 1547 0.400213 AAAAGGTCCAGCACATCCGA 59.600 50.0 0.00 0.0 0.00 4.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1773 1790 2.127708 AGGGCAGGAAAATAGTCCGAT 58.872 47.619 0.0 0.0 43.03 4.18 R
3369 3395 6.928492 TGCCTTTAAAACTCAACCATTCATTC 59.072 34.615 0.0 0.0 0.00 2.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 1.502163 GGATTTCTCAGGATGCGGCG 61.502 60.000 0.51 0.51 34.76 6.46
109 110 1.445582 GTCCGTCTACGCCACCTTG 60.446 63.158 0.00 0.00 38.18 3.61
228 231 3.611674 GGGCGGGTGGTTGGTTTG 61.612 66.667 0.00 0.00 0.00 2.93
571 574 5.311265 AGCAGATTTCACTCATTTCACTCA 58.689 37.500 0.00 0.00 0.00 3.41
750 765 4.219288 GTGGATTTGTGAGCAAGAAAGGAT 59.781 41.667 0.00 0.00 35.82 3.24
801 816 6.461509 CCATGTGTACTAGCTGATGTGACATA 60.462 42.308 0.00 0.00 0.00 2.29
864 880 1.388547 GAAGGTTGGCCATATTCGCA 58.611 50.000 6.09 0.00 37.19 5.10
1530 1547 0.400213 AAAAGGTCCAGCACATCCGA 59.600 50.000 0.00 0.00 0.00 4.55
1773 1790 5.932619 ACCATGTATACAGCTTCTGTGTA 57.067 39.130 11.91 4.74 45.01 2.90
1997 2014 1.875963 GACAGCCATTGTTGTCCCG 59.124 57.895 2.73 0.00 44.32 5.14
3244 3268 1.674359 TGGATTGTCCACACACACAC 58.326 50.000 0.00 0.00 42.67 3.82
3622 3651 1.196354 CGACGACGTCAAGGTCTAACT 59.804 52.381 26.26 0.00 34.75 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
109 110 2.278401 GTGATACGACCGGACGGC 60.278 66.667 28.68 17.84 39.32 5.68
228 231 1.915614 CTGACTGCCATGTTCCACGC 61.916 60.000 0.00 0.00 0.00 5.34
263 266 4.214332 CCGCAAACTAGAGAGAAAAGCTTT 59.786 41.667 5.69 5.69 0.00 3.51
264 267 3.748568 CCGCAAACTAGAGAGAAAAGCTT 59.251 43.478 0.00 0.00 0.00 3.74
750 765 6.883756 TGTCATAATTGCATGTCCACTCTTTA 59.116 34.615 0.00 0.00 0.00 1.85
864 880 0.039618 CCTACAAGTGTGGCCCCAAT 59.960 55.000 0.00 0.00 0.00 3.16
1530 1547 4.222336 CAAGATGGTCATACTCCTCCTCT 58.778 47.826 0.00 0.00 0.00 3.69
1773 1790 2.127708 AGGGCAGGAAAATAGTCCGAT 58.872 47.619 0.00 0.00 43.03 4.18
1997 2014 7.394872 CGTTGTTTGTGCTCTTATATCTTCTC 58.605 38.462 0.00 0.00 0.00 2.87
3243 3267 9.975464 AAGGGCTAAATCCTCCTATATATATGT 57.025 33.333 5.44 0.00 32.59 2.29
3369 3395 6.928492 TGCCTTTAAAACTCAACCATTCATTC 59.072 34.615 0.00 0.00 0.00 2.67
3604 3633 2.224606 TCAGTTAGACCTTGACGTCGT 58.775 47.619 11.62 0.00 37.85 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.