Multiple sequence alignment - TraesCS4B01G388500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G388500 chr4B 100.000 3814 0 0 1 3814 665610166 665613979 0.000000e+00 7044.0
1 TraesCS4B01G388500 chr5A 99.294 3823 17 5 1 3814 705591922 705595743 0.000000e+00 6902.0
2 TraesCS4B01G388500 chrUn 91.621 1826 108 21 2032 3814 108414477 108412654 0.000000e+00 2483.0
3 TraesCS4B01G388500 chrUn 94.308 1142 51 10 903 2032 108415655 108414516 0.000000e+00 1736.0
4 TraesCS4B01G388500 chrUn 90.919 914 70 6 903 1808 134378140 134377232 0.000000e+00 1216.0
5 TraesCS4B01G388500 chrUn 82.286 350 39 8 196 542 134379017 134378688 8.070000e-72 281.0
6 TraesCS4B01G388500 chrUn 80.175 343 66 2 1147 1488 282501116 282500775 4.890000e-64 255.0
7 TraesCS4B01G388500 chrUn 80.175 343 66 2 1147 1488 282507888 282507547 4.890000e-64 255.0
8 TraesCS4B01G388500 chrUn 80.175 343 66 2 1147 1488 296566931 296566590 4.890000e-64 255.0
9 TraesCS4B01G388500 chrUn 89.394 66 4 3 624 687 92778883 92778947 3.160000e-11 80.5
10 TraesCS4B01G388500 chr2A 81.481 351 59 6 1117 1464 9058063 9058410 2.240000e-72 283.0
11 TraesCS4B01G388500 chr2A 87.500 64 5 2 627 689 726203105 726203044 1.900000e-08 71.3
12 TraesCS4B01G388500 chr2A 87.500 64 5 2 627 689 726214542 726214481 1.900000e-08 71.3
13 TraesCS4B01G388500 chr2A 90.196 51 5 0 548 598 86679062 86679012 2.460000e-07 67.6
14 TraesCS4B01G388500 chr4A 75.000 616 135 12 2171 2775 713522666 713523273 2.260000e-67 267.0
15 TraesCS4B01G388500 chr1D 91.549 71 4 1 529 599 311688920 311688852 3.140000e-16 97.1
16 TraesCS4B01G388500 chr1D 85.135 74 5 4 627 695 48193879 48193807 1.900000e-08 71.3
17 TraesCS4B01G388500 chr5D 91.667 60 4 1 625 684 385950466 385950524 8.780000e-12 82.4
18 TraesCS4B01G388500 chr1B 86.842 76 3 3 529 599 421538158 421538085 1.140000e-10 78.7
19 TraesCS4B01G388500 chr7D 88.710 62 5 2 628 688 92761947 92761887 1.470000e-09 75.0
20 TraesCS4B01G388500 chr6B 87.500 64 8 0 2552 2615 113589515 113589578 1.470000e-09 75.0
21 TraesCS4B01G388500 chr7A 92.157 51 4 0 548 598 47927970 47928020 5.290000e-09 73.1
22 TraesCS4B01G388500 chr3B 90.909 55 4 1 632 686 223661961 223661908 5.290000e-09 73.1
23 TraesCS4B01G388500 chr2D 86.957 69 4 4 629 693 532427827 532427760 5.290000e-09 73.1
24 TraesCS4B01G388500 chr6A 90.196 51 5 0 548 598 52030147 52030097 2.460000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G388500 chr4B 665610166 665613979 3813 False 7044.0 7044 100.0000 1 3814 1 chr4B.!!$F1 3813
1 TraesCS4B01G388500 chr5A 705591922 705595743 3821 False 6902.0 6902 99.2940 1 3814 1 chr5A.!!$F1 3813
2 TraesCS4B01G388500 chrUn 108412654 108415655 3001 True 2109.5 2483 92.9645 903 3814 2 chrUn.!!$R4 2911
3 TraesCS4B01G388500 chrUn 134377232 134379017 1785 True 748.5 1216 86.6025 196 1808 2 chrUn.!!$R5 1612
4 TraesCS4B01G388500 chr4A 713522666 713523273 607 False 267.0 267 75.0000 2171 2775 1 chr4A.!!$F1 604

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
193 194 1.878211 TGGACATGCTGGGTAGATCA 58.122 50.0 0.0 0.0 0.0 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2828 3283 6.025749 TGCACGAGGAACAGAATATATAGG 57.974 41.667 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
193 194 1.878211 TGGACATGCTGGGTAGATCA 58.122 50.000 0.00 0.0 0.0 2.92
486 488 2.989422 AAAAATGGAGAAAGCGACCG 57.011 45.000 0.00 0.0 0.0 4.79
883 1261 7.496920 TCCAAATAAAAACATGAAACATGCACA 59.503 29.630 0.00 0.0 0.0 4.57
2931 3399 1.161843 TTCTCAAATTCCGTTCCCGC 58.838 50.000 0.00 0.0 0.0 6.13
3071 3540 1.340991 ACGATAATGCTTTGCTGGGGT 60.341 47.619 0.00 0.0 0.0 4.95
3240 3719 0.791422 CGTCTCGACTCGACACTCTT 59.209 55.000 5.47 0.0 0.0 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 7.538575 ACTGCCAACATTGATTACAAATAGAC 58.461 34.615 0.0 0.0 39.54 2.59
193 194 5.026121 TGGATAGGATCGAATATGCCTCTT 58.974 41.667 0.0 0.0 32.04 2.85
486 488 8.755696 ATATTCACGCTCTTCTCTTCATAATC 57.244 34.615 0.0 0.0 0.00 1.75
883 1261 1.974957 TGTACAGCACACTACCCATGT 59.025 47.619 0.0 0.0 30.04 3.21
2828 3283 6.025749 TGCACGAGGAACAGAATATATAGG 57.974 41.667 0.0 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.