Multiple sequence alignment - TraesCS4B01G386700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G386700 chr4B 100.000 3126 0 0 1 3126 665058813 665061938 0.000000e+00 5773.0
1 TraesCS4B01G386700 chr4B 99.360 3126 18 1 1 3126 665004327 665007450 0.000000e+00 5661.0
2 TraesCS4B01G386700 chr4B 99.232 3126 24 0 1 3126 664944925 664948050 0.000000e+00 5640.0
3 TraesCS4B01G386700 chr4B 98.976 3126 30 1 1 3126 664975716 664978839 0.000000e+00 5594.0
4 TraesCS4B01G386700 chr4B 99.832 2384 4 0 1 2384 665111876 665114259 0.000000e+00 4381.0
5 TraesCS4B01G386700 chr4B 99.876 1612 2 0 773 2384 665118757 665120368 0.000000e+00 2966.0
6 TraesCS4B01G386700 chr4B 99.116 1471 11 1 1658 3126 665116026 665117496 0.000000e+00 2643.0
7 TraesCS4B01G386700 chrUn 93.040 2184 109 9 788 2943 108906075 108903907 0.000000e+00 3151.0
8 TraesCS4B01G386700 chrUn 82.159 1816 224 67 187 1960 108967763 108966006 0.000000e+00 1467.0
9 TraesCS4B01G386700 chrUn 81.216 559 82 12 198 740 108906647 108906096 2.230000e-116 429.0
10 TraesCS4B01G386700 chrUn 85.567 194 22 5 2725 2912 87230691 87230884 6.840000e-47 198.0
11 TraesCS4B01G386700 chr7D 92.547 161 11 1 2731 2890 568395946 568396106 2.420000e-56 230.0
12 TraesCS4B01G386700 chr5B 86.979 192 19 4 2732 2919 267193886 267194075 8.780000e-51 211.0
13 TraesCS4B01G386700 chr6D 86.486 185 20 4 2737 2918 450470497 450470315 6.840000e-47 198.0
14 TraesCS4B01G386700 chr6D 93.333 60 4 0 129 188 121815099 121815158 4.290000e-14 89.8
15 TraesCS4B01G386700 chr3B 83.766 154 21 4 2973 3125 785978955 785979105 3.250000e-30 143.0
16 TraesCS4B01G386700 chr2B 93.651 63 2 2 129 191 416000603 416000663 3.320000e-15 93.5
17 TraesCS4B01G386700 chr7A 93.333 60 3 1 129 188 707687334 707687276 1.540000e-13 87.9
18 TraesCS4B01G386700 chr5D 93.333 60 3 1 129 188 529762123 529762065 1.540000e-13 87.9
19 TraesCS4B01G386700 chr1A 93.333 60 3 1 129 188 175176122 175176180 1.540000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G386700 chr4B 665058813 665061938 3125 False 5773 5773 100.000 1 3126 1 chr4B.!!$F4 3125
1 TraesCS4B01G386700 chr4B 665004327 665007450 3123 False 5661 5661 99.360 1 3126 1 chr4B.!!$F3 3125
2 TraesCS4B01G386700 chr4B 664944925 664948050 3125 False 5640 5640 99.232 1 3126 1 chr4B.!!$F1 3125
3 TraesCS4B01G386700 chr4B 664975716 664978839 3123 False 5594 5594 98.976 1 3126 1 chr4B.!!$F2 3125
4 TraesCS4B01G386700 chr4B 665111876 665120368 8492 False 3330 4381 99.608 1 3126 3 chr4B.!!$F5 3125
5 TraesCS4B01G386700 chrUn 108903907 108906647 2740 True 1790 3151 87.128 198 2943 2 chrUn.!!$R2 2745
6 TraesCS4B01G386700 chrUn 108966006 108967763 1757 True 1467 1467 82.159 187 1960 1 chrUn.!!$R1 1773

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1656 1736 2.433436 GGCGGTACCAAAGAATTGTCT 58.567 47.619 13.54 0.0 38.86 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2971 5556 1.072965 GGGATTTCGGGATCAGCTGAT 59.927 52.381 29.09 29.09 37.51 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1656 1736 2.433436 GGCGGTACCAAAGAATTGTCT 58.567 47.619 13.54 0.00 38.86 3.41
2643 5224 1.691976 TGTTGACCGAGGTGAATGAGT 59.308 47.619 0.00 0.00 0.00 3.41
2837 5420 7.691993 TGGGTTATCTCTTAGCCTTATCTTT 57.308 36.000 0.00 0.00 32.03 2.52
2971 5556 0.895530 ATTCGTTTCTGAGCTCGGGA 59.104 50.000 22.38 11.69 0.00 5.14
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1656 1736 1.517238 TAATGGTGCCATCTGCCCTA 58.483 50.000 3.96 0.00 40.16 3.53
2971 5556 1.072965 GGGATTTCGGGATCAGCTGAT 59.927 52.381 29.09 29.09 37.51 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.