Multiple sequence alignment - TraesCS4B01G386600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G386600 chr4B 100.000 2557 0 0 1 2557 665031008 665033564 0.000000e+00 4723.0
1 TraesCS4B01G386600 chr4B 98.829 2563 23 5 1 2557 664979181 664981742 0.000000e+00 4560.0
2 TraesCS4B01G386600 chr4B 98.011 2564 25 7 1 2557 665084095 665086639 0.000000e+00 4429.0
3 TraesCS4B01G386600 chr4B 94.428 1974 66 16 619 2557 610738171 610740135 0.000000e+00 2996.0
4 TraesCS4B01G386600 chr4B 98.706 618 7 1 1 618 664940498 664941114 0.000000e+00 1096.0
5 TraesCS4B01G386600 chr4B 98.544 618 9 0 1 618 664971250 664971867 0.000000e+00 1092.0
6 TraesCS4B01G386600 chr4B 97.368 228 5 1 1 228 664939903 664940129 1.110000e-103 387.0
7 TraesCS4B01G386600 chr4B 82.234 394 57 6 227 618 665149861 665150243 6.820000e-86 327.0
8 TraesCS4B01G386600 chr6B 95.069 1967 65 14 615 2557 659676043 659678001 0.000000e+00 3066.0
9 TraesCS4B01G386600 chr6B 92.966 1976 70 15 619 2557 20190030 20191973 0.000000e+00 2815.0
10 TraesCS4B01G386600 chrUn 95.000 1960 70 10 618 2557 8335943 8333992 0.000000e+00 3051.0
11 TraesCS4B01G386600 chrUn 88.710 124 14 0 495 618 108879913 108879790 4.410000e-33 152.0
12 TraesCS4B01G386600 chrUn 92.754 69 1 2 2489 2557 476350448 476350512 2.090000e-16 97.1
13 TraesCS4B01G386600 chr3B 94.082 1960 80 15 619 2557 778669293 778667349 0.000000e+00 2944.0
14 TraesCS4B01G386600 chr3B 92.505 1988 67 17 619 2557 10697635 10699589 0.000000e+00 2771.0
15 TraesCS4B01G386600 chr3B 93.887 1456 54 7 624 2055 812910294 812911738 0.000000e+00 2163.0
16 TraesCS4B01G386600 chr2B 94.790 1881 64 14 615 2464 691248391 691246514 0.000000e+00 2900.0
17 TraesCS4B01G386600 chr4A 94.835 1878 62 15 616 2464 729212419 729210548 0.000000e+00 2898.0
18 TraesCS4B01G386600 chr4A 88.158 228 23 4 2 228 700964729 700964953 4.190000e-68 268.0
19 TraesCS4B01G386600 chr7D 93.986 1879 71 15 618 2464 19181757 19183625 0.000000e+00 2806.0
20 TraesCS4B01G386600 chr7D 93.359 1792 58 21 614 2373 71219434 71221196 0.000000e+00 2593.0
21 TraesCS4B01G386600 chr7D 95.395 304 14 0 611 914 625663410 625663107 3.820000e-133 484.0
22 TraesCS4B01G386600 chr7A 92.630 1886 76 20 619 2464 692142019 692140157 0.000000e+00 2654.0
23 TraesCS4B01G386600 chr7A 88.158 228 25 2 2 228 696556785 696556559 1.170000e-68 270.0
24 TraesCS4B01G386600 chr5A 82.952 393 55 7 227 618 704636355 704636736 6.770000e-91 344.0
25 TraesCS4B01G386600 chr5D 89.912 228 20 3 2 228 302850758 302850983 8.950000e-75 291.0
26 TraesCS4B01G386600 chr1B 87.444 223 25 3 3 224 677771987 677771767 1.170000e-63 254.0
27 TraesCS4B01G386600 chr4D 100.000 44 0 0 2514 2557 12217208 12217165 5.860000e-12 82.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G386600 chr4B 665031008 665033564 2556 False 4723.0 4723 100.000 1 2557 1 chr4B.!!$F4 2556
1 TraesCS4B01G386600 chr4B 664979181 664981742 2561 False 4560.0 4560 98.829 1 2557 1 chr4B.!!$F3 2556
2 TraesCS4B01G386600 chr4B 665084095 665086639 2544 False 4429.0 4429 98.011 1 2557 1 chr4B.!!$F5 2556
3 TraesCS4B01G386600 chr4B 610738171 610740135 1964 False 2996.0 2996 94.428 619 2557 1 chr4B.!!$F1 1938
4 TraesCS4B01G386600 chr4B 664971250 664971867 617 False 1092.0 1092 98.544 1 618 1 chr4B.!!$F2 617
5 TraesCS4B01G386600 chr4B 664939903 664941114 1211 False 741.5 1096 98.037 1 618 2 chr4B.!!$F7 617
6 TraesCS4B01G386600 chr6B 659676043 659678001 1958 False 3066.0 3066 95.069 615 2557 1 chr6B.!!$F2 1942
7 TraesCS4B01G386600 chr6B 20190030 20191973 1943 False 2815.0 2815 92.966 619 2557 1 chr6B.!!$F1 1938
8 TraesCS4B01G386600 chrUn 8333992 8335943 1951 True 3051.0 3051 95.000 618 2557 1 chrUn.!!$R1 1939
9 TraesCS4B01G386600 chr3B 778667349 778669293 1944 True 2944.0 2944 94.082 619 2557 1 chr3B.!!$R1 1938
10 TraesCS4B01G386600 chr3B 10697635 10699589 1954 False 2771.0 2771 92.505 619 2557 1 chr3B.!!$F1 1938
11 TraesCS4B01G386600 chr3B 812910294 812911738 1444 False 2163.0 2163 93.887 624 2055 1 chr3B.!!$F2 1431
12 TraesCS4B01G386600 chr2B 691246514 691248391 1877 True 2900.0 2900 94.790 615 2464 1 chr2B.!!$R1 1849
13 TraesCS4B01G386600 chr4A 729210548 729212419 1871 True 2898.0 2898 94.835 616 2464 1 chr4A.!!$R1 1848
14 TraesCS4B01G386600 chr7D 19181757 19183625 1868 False 2806.0 2806 93.986 618 2464 1 chr7D.!!$F1 1846
15 TraesCS4B01G386600 chr7D 71219434 71221196 1762 False 2593.0 2593 93.359 614 2373 1 chr7D.!!$F2 1759
16 TraesCS4B01G386600 chr7A 692140157 692142019 1862 True 2654.0 2654 92.630 619 2464 1 chr7A.!!$R1 1845

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
789 1385 3.314331 AGGTGAGCAGGACCCACG 61.314 66.667 0.0 0.0 33.51 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2092 2789 5.298276 TGCTAACTAGAACCAACCTTTTGTG 59.702 40.0 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
789 1385 3.314331 AGGTGAGCAGGACCCACG 61.314 66.667 0.00 0.0 33.51 4.94
1281 1931 5.796502 TGGGATTTAGGGTTCATCTTTCT 57.203 39.130 0.00 0.0 0.00 2.52
1460 2110 0.325484 CTGGCAATTCCATTGGGGGA 60.325 55.000 2.09 0.0 45.50 4.81
2092 2789 2.032290 GTCCCGTGTTGTTTCAGCTAAC 60.032 50.000 0.00 0.0 0.00 2.34
2140 2837 5.525378 AGTCTAACTTGCAGTCTTTGTGAAG 59.475 40.000 0.00 0.0 0.00 3.02
2177 2874 9.476202 GCAATTGTTTGGTTCTAGTTTATTTCT 57.524 29.630 7.40 0.0 33.22 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
789 1385 0.331616 AAGTTAGTGGGTCCCATGCC 59.668 55.000 15.49 0.59 35.28 4.40
1281 1931 6.146510 GTGCATTGCTTCAATTTCTGAAATCA 59.853 34.615 15.43 6.71 43.54 2.57
1460 2110 4.447342 CCAATGGAAGGGCGGGCT 62.447 66.667 0.00 0.00 0.00 5.19
2092 2789 5.298276 TGCTAACTAGAACCAACCTTTTGTG 59.702 40.000 0.00 0.00 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.