Multiple sequence alignment - TraesCS4B01G386500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G386500 chr4B 100.000 3316 0 0 1 3316 665004255 665007570 0.000000e+00 6124.0
1 TraesCS4B01G386500 chr4B 99.458 3318 16 1 1 3316 664944853 664948170 0.000000e+00 6026.0
2 TraesCS4B01G386500 chr4B 99.277 3318 21 2 1 3316 665058741 665062057 0.000000e+00 5991.0
3 TraesCS4B01G386500 chr4B 98.974 3313 33 1 1 3313 664975644 664978955 0.000000e+00 5928.0
4 TraesCS4B01G386500 chr4B 99.349 2456 14 1 1 2454 665111804 665114259 0.000000e+00 4446.0
5 TraesCS4B01G386500 chr4B 99.504 1612 8 0 843 2454 665118757 665120368 0.000000e+00 2933.0
6 TraesCS4B01G386500 chr4B 98.554 1591 19 2 1728 3316 665116026 665117614 0.000000e+00 2808.0
7 TraesCS4B01G386500 chrUn 93.407 2184 101 9 858 3013 108906075 108903907 0.000000e+00 3195.0
8 TraesCS4B01G386500 chrUn 82.178 1818 218 72 259 2030 108967763 108966006 0.000000e+00 1465.0
9 TraesCS4B01G386500 chrUn 81.149 557 84 12 270 810 108906647 108906096 8.500000e-116 427.0
10 TraesCS4B01G386500 chr5A 91.667 168 12 2 2801 2966 632587697 632587530 7.150000e-57 231.0
11 TraesCS4B01G386500 chr4D 87.302 189 22 2 2802 2988 506326070 506325882 7.200000e-52 215.0
12 TraesCS4B01G386500 chr3D 86.842 190 22 2 2802 2988 169450190 169450379 3.350000e-50 209.0
13 TraesCS4B01G386500 chr5B 86.458 192 20 4 2802 2989 267193886 267194075 4.340000e-49 206.0
14 TraesCS4B01G386500 chr3B 85.556 180 22 4 3043 3221 785978955 785979131 5.650000e-43 185.0
15 TraesCS4B01G386500 chr2B 93.651 63 2 2 201 263 416000603 416000663 3.520000e-15 93.5
16 TraesCS4B01G386500 chr2B 100.000 31 0 0 3031 3061 116273562 116273532 1.280000e-04 58.4
17 TraesCS4B01G386500 chr6D 93.333 60 4 0 201 260 121815099 121815158 4.560000e-14 89.8
18 TraesCS4B01G386500 chr7A 93.333 60 3 1 201 260 707687334 707687276 1.640000e-13 87.9
19 TraesCS4B01G386500 chr5D 93.333 60 3 1 201 260 529762123 529762065 1.640000e-13 87.9
20 TraesCS4B01G386500 chr1A 93.333 60 3 1 201 260 175176122 175176180 1.640000e-13 87.9
21 TraesCS4B01G386500 chr2A 92.105 38 3 0 3023 3060 45087414 45087451 2.000000e-03 54.7
22 TraesCS4B01G386500 chr2D 100.000 28 0 0 3033 3060 403500582 403500555 6.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G386500 chr4B 665004255 665007570 3315 False 6124.000000 6124 100.000000 1 3316 1 chr4B.!!$F3 3315
1 TraesCS4B01G386500 chr4B 664944853 664948170 3317 False 6026.000000 6026 99.458000 1 3316 1 chr4B.!!$F1 3315
2 TraesCS4B01G386500 chr4B 665058741 665062057 3316 False 5991.000000 5991 99.277000 1 3316 1 chr4B.!!$F4 3315
3 TraesCS4B01G386500 chr4B 664975644 664978955 3311 False 5928.000000 5928 98.974000 1 3313 1 chr4B.!!$F2 3312
4 TraesCS4B01G386500 chr4B 665111804 665120368 8564 False 3395.666667 4446 99.135667 1 3316 3 chr4B.!!$F5 3315
5 TraesCS4B01G386500 chrUn 108903907 108906647 2740 True 1811.000000 3195 87.278000 270 3013 2 chrUn.!!$R2 2743
6 TraesCS4B01G386500 chrUn 108966006 108967763 1757 True 1465.000000 1465 82.178000 259 2030 1 chrUn.!!$R1 1771

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
28 29 1.433534 GCTAGACAGTGCAACCTCAC 58.566 55.0 0.0 0.0 37.8 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3289 5876 0.320771 GCTCTCCGGCAGTCTTTTGA 60.321 55.0 0.0 0.0 0.0 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 1.433534 GCTAGACAGTGCAACCTCAC 58.566 55.000 0.0 0.0 37.80 3.51
512 522 1.745653 GCCCAAATAGCTCTTGTGTCC 59.254 52.381 0.0 0.0 0.00 4.02
841 870 9.850198 TCTGATCCATTCAATTACATTACATGA 57.150 29.630 0.0 0.0 32.78 3.07
2716 5299 0.532573 GACCGAGGTGAATGAGCTGA 59.467 55.000 0.0 0.0 30.42 4.26
3029 5616 7.065803 AGTGACAAAAGTATGGGATATTCGTTG 59.934 37.037 0.0 0.0 0.00 4.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
512 522 5.388475 GCCGTTTCTATATTATGTGCTGTCG 60.388 44.0 0.0 0.0 0.0 4.35
841 870 6.273071 AGCAAAGAAATCGTAGCAAGTTTTT 58.727 32.0 0.0 0.0 0.0 1.94
3289 5876 0.320771 GCTCTCCGGCAGTCTTTTGA 60.321 55.0 0.0 0.0 0.0 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.