Multiple sequence alignment - TraesCS4B01G386400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G386400 chr4B 100.000 3381 0 0 1 3381 664975597 664978977 0.000000e+00 6244.0
1 TraesCS4B01G386400 chr4B 99.054 3384 29 2 1 3381 664944806 664948189 0.000000e+00 6069.0
2 TraesCS4B01G386400 chr4B 98.965 3383 33 1 1 3381 665058694 665062076 0.000000e+00 6052.0
3 TraesCS4B01G386400 chr4B 98.965 3382 34 1 1 3381 665004208 665007589 0.000000e+00 6050.0
4 TraesCS4B01G386400 chr4B 99.081 2503 21 1 1 2501 665111757 665114259 0.000000e+00 4494.0
5 TraesCS4B01G386400 chr4B 99.442 1612 9 0 890 2501 665118757 665120368 0.000000e+00 2928.0
6 TraesCS4B01G386400 chr4B 98.571 1609 20 2 1775 3381 665116026 665117633 0.000000e+00 2841.0
7 TraesCS4B01G386400 chrUn 93.132 2184 107 9 905 3060 108906075 108903907 0.000000e+00 3162.0
8 TraesCS4B01G386400 chrUn 82.048 1816 224 69 306 2077 108967763 108966006 0.000000e+00 1454.0
9 TraesCS4B01G386400 chrUn 81.149 557 84 12 317 857 108906647 108906096 8.670000e-116 427.0
10 TraesCS4B01G386400 chrUn 83.562 73 10 2 3065 3136 230309382 230309453 2.180000e-07 67.6
11 TraesCS4B01G386400 chr5A 91.071 168 13 2 2848 3013 632587697 632587530 3.390000e-55 226.0
12 TraesCS4B01G386400 chr2B 90.303 165 14 1 2851 3013 796466261 796466097 7.350000e-52 215.0
13 TraesCS4B01G386400 chr4D 86.772 189 23 2 2849 3035 506326070 506325882 3.420000e-50 209.0
14 TraesCS4B01G386400 chr3D 86.316 190 23 2 2849 3035 169450190 169450379 1.590000e-48 204.0
15 TraesCS4B01G386400 chr3B 80.913 241 36 9 3090 3327 785978955 785979188 7.450000e-42 182.0
16 TraesCS4B01G386400 chr3B 86.885 61 6 2 249 308 7295800 7295859 2.180000e-07 67.6
17 TraesCS4B01G386400 chr5B 75.221 226 51 5 3062 3285 701015615 701015837 5.970000e-18 102.0
18 TraesCS4B01G386400 chr5B 73.543 223 54 5 3065 3285 63474485 63474704 2.800000e-11 80.5
19 TraesCS4B01G386400 chr1D 91.667 60 5 0 248 307 99686091 99686150 2.160000e-12 84.2
20 TraesCS4B01G386400 chr6B 90.000 60 5 1 249 307 79946971 79946912 3.620000e-10 76.8
21 TraesCS4B01G386400 chr6B 90.000 60 5 1 249 307 80001047 80000988 3.620000e-10 76.8
22 TraesCS4B01G386400 chr1A 90.000 60 5 1 248 307 175176122 175176180 3.620000e-10 76.8
23 TraesCS4B01G386400 chr1B 83.562 73 10 2 3065 3136 59991740 59991669 2.180000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G386400 chr4B 664975597 664978977 3380 False 6244.0 6244 100.000000 1 3381 1 chr4B.!!$F2 3380
1 TraesCS4B01G386400 chr4B 664944806 664948189 3383 False 6069.0 6069 99.054000 1 3381 1 chr4B.!!$F1 3380
2 TraesCS4B01G386400 chr4B 665058694 665062076 3382 False 6052.0 6052 98.965000 1 3381 1 chr4B.!!$F4 3380
3 TraesCS4B01G386400 chr4B 665004208 665007589 3381 False 6050.0 6050 98.965000 1 3381 1 chr4B.!!$F3 3380
4 TraesCS4B01G386400 chr4B 665111757 665120368 8611 False 3421.0 4494 99.031333 1 3381 3 chr4B.!!$F5 3380
5 TraesCS4B01G386400 chrUn 108903907 108906647 2740 True 1794.5 3162 87.140500 317 3060 2 chrUn.!!$R2 2743
6 TraesCS4B01G386400 chrUn 108966006 108967763 1757 True 1454.0 1454 82.048000 306 2077 1 chrUn.!!$R1 1771

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
280 281 1.102978 TCGATTGATGCAGAGGACGA 58.897 50.000 0.00 0.00 0.0 4.20 F
1839 4414 5.112686 GCCCTTGAGAACTATAGACAACTG 58.887 45.833 6.78 1.68 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1839 4414 5.116882 GGGGTATAGAATGCACGAATATCC 58.883 45.833 0.0 0.0 0.0 2.59 R
3063 5650 3.053455 GAGCTCAGAAACGAATATCCCG 58.947 50.000 9.4 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
280 281 1.102978 TCGATTGATGCAGAGGACGA 58.897 50.000 0.00 0.00 0.00 4.20
1839 4414 5.112686 GCCCTTGAGAACTATAGACAACTG 58.887 45.833 6.78 1.68 0.00 3.16
2238 4821 3.646650 CAAATGGTATTGCTGCCCG 57.353 52.632 0.00 0.00 0.00 6.13
2860 5443 2.439507 CCCACTCTGTAAGGGCATGTAT 59.560 50.000 0.00 0.00 38.84 2.29
3085 5672 3.490933 CGGGATATTCGTTTCTGAGCTCA 60.491 47.826 17.19 17.19 0.00 4.26
3138 5725 2.754186 GCTAGCATTGGGATGGGTGAAT 60.754 50.000 10.63 0.00 33.72 2.57
3229 5816 2.857186 TGCAGCAACAGATGTAAGGA 57.143 45.000 0.00 0.00 0.00 3.36
3359 5947 2.363018 ACTGCCGGAGAGCTGCTA 60.363 61.111 5.05 0.00 35.29 3.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
105 106 5.128991 GGTAGTTATACAGCAAGGGAAGAGT 59.871 44.000 0.00 0.0 33.21 3.24
204 205 1.546476 CGCATATCCCTACACCTCCTC 59.454 57.143 0.00 0.0 0.00 3.71
280 281 7.743116 TTTTTAGAAAAAGGAGGAAAACCCT 57.257 32.000 0.00 0.0 39.33 4.34
1839 4414 5.116882 GGGGTATAGAATGCACGAATATCC 58.883 45.833 0.00 0.0 0.00 2.59
1911 4486 6.603237 TGTTTGCCAGATAGATTATTGTCG 57.397 37.500 0.00 0.0 0.00 4.35
2093 4676 6.894682 TCATGTGCTACTTTATCCATTACCA 58.105 36.000 0.00 0.0 0.00 3.25
2238 4821 9.950680 CATCAACACACCTTTAATCATATTACC 57.049 33.333 0.00 0.0 0.00 2.85
2860 5443 9.675464 AAGATAAGACCGTTTAATCAACCATTA 57.325 29.630 0.00 0.0 30.65 1.90
3063 5650 3.053455 GAGCTCAGAAACGAATATCCCG 58.947 50.000 9.40 0.0 0.00 5.14
3204 5791 6.208402 TCCTTACATCTGTTGCTGCATTTAAA 59.792 34.615 1.84 0.0 0.00 1.52
3229 5816 3.508793 TCGAATTAGGTGTTCCGTCTCTT 59.491 43.478 0.00 0.0 39.05 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.