Multiple sequence alignment - TraesCS4B01G372700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G372700 chr4B 100.000 3739 0 0 352 4090 657514940 657518678 0.000000e+00 6905.0
1 TraesCS4B01G372700 chr4B 99.636 2199 4 2 352 2550 657497755 657499949 0.000000e+00 4013.0
2 TraesCS4B01G372700 chr4B 85.056 1064 128 21 2038 3089 657527404 657528448 0.000000e+00 1055.0
3 TraesCS4B01G372700 chr4B 84.275 655 71 16 507 1146 657525995 657526632 9.720000e-171 610.0
4 TraesCS4B01G372700 chr4B 83.539 486 69 9 3417 3895 657528639 657529120 1.040000e-120 444.0
5 TraesCS4B01G372700 chr4B 85.422 391 49 5 934 1317 657509732 657510121 2.290000e-107 399.0
6 TraesCS4B01G372700 chr4B 100.000 167 0 0 1 167 657514589 657514755 3.970000e-80 309.0
7 TraesCS4B01G372700 chr4B 95.349 172 3 1 1 167 657497538 657497709 6.740000e-68 268.0
8 TraesCS4B01G372700 chr4B 94.268 157 4 1 1807 1963 648912101 648912252 6.830000e-58 235.0
9 TraesCS4B01G372700 chr4D 96.217 2009 67 7 1964 3971 509340049 509338049 0.000000e+00 3280.0
10 TraesCS4B01G372700 chr4D 90.386 1269 56 26 352 1583 509341614 509340375 0.000000e+00 1607.0
11 TraesCS4B01G372700 chr4D 85.795 1056 125 15 2038 3084 509283456 509282417 0.000000e+00 1096.0
12 TraesCS4B01G372700 chr4D 83.223 906 96 31 507 1373 509284719 509283831 0.000000e+00 780.0
13 TraesCS4B01G372700 chr4D 83.878 459 55 8 3417 3874 509282229 509281789 1.760000e-113 420.0
14 TraesCS4B01G372700 chr4D 94.850 233 8 1 1582 1810 509340271 509340039 1.080000e-95 361.0
15 TraesCS4B01G372700 chr4D 89.407 236 21 3 513 748 509326332 509326101 1.110000e-75 294.0
16 TraesCS4B01G372700 chr4D 86.957 276 18 7 507 782 509355835 509355578 1.110000e-75 294.0
17 TraesCS4B01G372700 chr4D 95.161 62 0 3 4028 4088 509338052 509337993 1.210000e-15 95.3
18 TraesCS4B01G372700 chr4D 80.672 119 16 4 1559 1676 509283751 509283639 7.280000e-13 86.1
19 TraesCS4B01G372700 chr4D 100.000 33 0 0 1759 1791 509340119 509340087 1.230000e-05 62.1
20 TraesCS4B01G372700 chr5A 94.289 1891 78 14 1964 3842 698179854 698177982 0.000000e+00 2867.0
21 TraesCS4B01G372700 chr5A 88.641 1435 73 35 364 1762 698181243 698179863 0.000000e+00 1664.0
22 TraesCS4B01G372700 chr5A 84.615 1066 142 16 2038 3093 698163108 698162055 0.000000e+00 1040.0
23 TraesCS4B01G372700 chr5A 82.438 894 98 36 507 1365 698164397 698163528 0.000000e+00 726.0
24 TraesCS4B01G372700 chr5A 94.853 136 7 0 3953 4088 698177448 698177313 3.200000e-51 213.0
25 TraesCS4B01G372700 chr5A 98.667 75 1 0 3839 3913 698177726 698177652 2.560000e-27 134.0
26 TraesCS4B01G372700 chr5A 98.077 52 1 0 1759 1810 698179895 698179844 1.570000e-14 91.6
27 TraesCS4B01G372700 chrUn 99.740 1539 4 0 2552 4090 343816555 343818093 0.000000e+00 2820.0
28 TraesCS4B01G372700 chrUn 84.275 655 71 16 507 1146 402488527 402487890 9.720000e-171 610.0
29 TraesCS4B01G372700 chrUn 85.422 391 49 5 934 1317 324637536 324637147 2.290000e-107 399.0
30 TraesCS4B01G372700 chrUn 94.375 160 7 1 1807 1966 326647639 326647482 1.140000e-60 244.0
31 TraesCS4B01G372700 chr2B 97.468 158 4 0 1808 1965 489851989 489852146 1.870000e-68 270.0
32 TraesCS4B01G372700 chr2B 95.679 162 6 1 1805 1965 764851934 764852095 4.060000e-65 259.0
33 TraesCS4B01G372700 chr3D 97.452 157 4 0 1807 1963 315463390 315463546 6.740000e-68 268.0
34 TraesCS4B01G372700 chr3A 95.322 171 5 3 1799 1969 374321126 374321293 6.740000e-68 268.0
35 TraesCS4B01G372700 chr6A 94.839 155 8 0 1809 1963 554713787 554713941 4.080000e-60 243.0
36 TraesCS4B01G372700 chr2D 93.082 159 11 0 1807 1965 522546574 522546732 2.460000e-57 233.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G372700 chr4B 657514589 657518678 4089 False 3607.000 6905 100.0000 1 4090 2 chr4B.!!$F4 4089
1 TraesCS4B01G372700 chr4B 657497538 657499949 2411 False 2140.500 4013 97.4925 1 2550 2 chr4B.!!$F3 2549
2 TraesCS4B01G372700 chr4B 657525995 657529120 3125 False 703.000 1055 84.2900 507 3895 3 chr4B.!!$F5 3388
3 TraesCS4B01G372700 chr4D 509337993 509341614 3621 True 1081.080 3280 95.3228 352 4088 5 chr4D.!!$R4 3736
4 TraesCS4B01G372700 chr4D 509281789 509284719 2930 True 595.525 1096 83.3920 507 3874 4 chr4D.!!$R3 3367
5 TraesCS4B01G372700 chr5A 698177313 698181243 3930 True 993.920 2867 94.9054 364 4088 5 chr5A.!!$R2 3724
6 TraesCS4B01G372700 chr5A 698162055 698164397 2342 True 883.000 1040 83.5265 507 3093 2 chr5A.!!$R1 2586
7 TraesCS4B01G372700 chrUn 343816555 343818093 1538 False 2820.000 2820 99.7400 2552 4090 1 chrUn.!!$F1 1538
8 TraesCS4B01G372700 chrUn 402487890 402488527 637 True 610.000 610 84.2750 507 1146 1 chrUn.!!$R3 639

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
470 477 3.286404 TGGATGGCCCATGACAAAG 57.714 52.632 0.0 0.0 40.82 2.77 F
2765 3153 8.993121 GCGATCTTATGATTATTTTCCTCTTGA 58.007 33.333 0.0 0.0 32.19 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2766 3154 3.692101 CCGTAAAATGGCACCTGAACATA 59.308 43.478 0.0 0.0 0.0 2.29 R
3985 4813 1.078848 CCAGCTTGAGGTTCGAGGG 60.079 63.158 0.0 0.0 0.0 4.30 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
470 477 3.286404 TGGATGGCCCATGACAAAG 57.714 52.632 0.00 0.00 40.82 2.77
2765 3153 8.993121 GCGATCTTATGATTATTTTCCTCTTGA 58.007 33.333 0.00 0.00 32.19 3.02
3985 4813 0.250166 GGATATGGCACCGGTGGTAC 60.250 60.000 34.58 18.69 32.11 3.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
6 7 5.127491 GGACCCATATGTTCCGATTTACAA 58.873 41.667 1.24 0.0 0.00 2.41
131 137 2.437716 CGGGATGAAACCACCGGG 60.438 66.667 6.32 0.0 42.48 5.73
2765 3153 4.338118 CCGTAAAATGGCACCTGAACATAT 59.662 41.667 0.00 0.0 0.00 1.78
2766 3154 3.692101 CCGTAAAATGGCACCTGAACATA 59.308 43.478 0.00 0.0 0.00 2.29
3985 4813 1.078848 CCAGCTTGAGGTTCGAGGG 60.079 63.158 0.00 0.0 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.