Multiple sequence alignment - TraesCS4B01G370100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G370100 chr4B 100.000 2264 0 0 1 2264 655790980 655793243 0 4181
1 TraesCS4B01G370100 chr4B 99.117 2264 19 1 1 2264 649623169 649625431 0 4069
2 TraesCS4B01G370100 chr7B 99.117 2264 19 1 1 2264 102652614 102654876 0 4069
3 TraesCS4B01G370100 chr7B 98.852 2264 24 1 1 2264 133432651 133430390 0 4036
4 TraesCS4B01G370100 chr4A 99.072 2264 19 1 1 2264 735292697 735294958 0 4063
5 TraesCS4B01G370100 chr5B 98.940 2264 22 1 1 2264 281832851 281830590 0 4047
6 TraesCS4B01G370100 chr5B 98.631 2264 30 1 1 2264 351469614 351467352 0 4008
7 TraesCS4B01G370100 chr1B 98.675 2264 29 1 1 2264 302772356 302770094 0 4013
8 TraesCS4B01G370100 chr7A 98.278 2265 35 3 1 2264 16005013 16007274 0 3964
9 TraesCS4B01G370100 chr2A 98.277 2264 37 1 1 2264 728933674 728935935 0 3964


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G370100 chr4B 655790980 655793243 2263 False 4181 4181 100.000 1 2264 1 chr4B.!!$F2 2263
1 TraesCS4B01G370100 chr4B 649623169 649625431 2262 False 4069 4069 99.117 1 2264 1 chr4B.!!$F1 2263
2 TraesCS4B01G370100 chr7B 102652614 102654876 2262 False 4069 4069 99.117 1 2264 1 chr7B.!!$F1 2263
3 TraesCS4B01G370100 chr7B 133430390 133432651 2261 True 4036 4036 98.852 1 2264 1 chr7B.!!$R1 2263
4 TraesCS4B01G370100 chr4A 735292697 735294958 2261 False 4063 4063 99.072 1 2264 1 chr4A.!!$F1 2263
5 TraesCS4B01G370100 chr5B 281830590 281832851 2261 True 4047 4047 98.940 1 2264 1 chr5B.!!$R1 2263
6 TraesCS4B01G370100 chr5B 351467352 351469614 2262 True 4008 4008 98.631 1 2264 1 chr5B.!!$R2 2263
7 TraesCS4B01G370100 chr1B 302770094 302772356 2262 True 4013 4013 98.675 1 2264 1 chr1B.!!$R1 2263
8 TraesCS4B01G370100 chr7A 16005013 16007274 2261 False 3964 3964 98.278 1 2264 1 chr7A.!!$F1 2263
9 TraesCS4B01G370100 chr2A 728933674 728935935 2261 False 3964 3964 98.277 1 2264 1 chr2A.!!$F1 2263

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
795 797 1.59813 GGTCGAGCAGCCACAAGTT 60.598 57.895 10.3 0.0 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2124 2126 0.904649 CAGACACACCAGATGGCCTA 59.095 55.0 3.32 0.0 39.32 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
795 797 1.598130 GGTCGAGCAGCCACAAGTT 60.598 57.895 10.3 0.0 0.00 2.66
917 919 8.680903 CCAGATGGTTGATCTAATAATAATGGC 58.319 37.037 0.0 0.0 39.64 4.40
1483 1485 1.668101 GGGAGCGTCGTGAGAAGGAT 61.668 60.000 0.0 0.0 45.01 3.24
1757 1759 7.582435 TTTCTGTCATTCGAGACTATTTGAC 57.418 36.000 6.4 0.0 39.27 3.18
1853 1855 8.090214 AGCATGCTTTGTTCATATTTAACAGTT 58.910 29.630 16.3 0.0 38.05 3.16
2158 2160 0.396435 GTCTGATGGACACCCACACA 59.604 55.000 0.0 0.0 46.98 3.72
2228 2230 1.302752 TCTGGCGTGCTTTGCTCAT 60.303 52.632 0.0 0.0 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
795 797 0.675837 CGACCACGACCACCTCTAGA 60.676 60.000 0.00 0.00 42.66 2.43
1757 1759 6.541969 TGACGAACATAGTTTGCACATAATG 58.458 36.000 0.00 0.00 0.00 1.90
1853 1855 4.909696 TGCTTAGCAACAACTAGCAAAA 57.090 36.364 3.67 0.00 34.76 2.44
2124 2126 0.904649 CAGACACACCAGATGGCCTA 59.095 55.000 3.32 0.00 39.32 3.93
2155 2157 2.282462 GCCAGGGACCTTGGTGTG 60.282 66.667 22.80 0.00 0.00 3.82
2158 2160 3.637273 GACGCCAGGGACCTTGGT 61.637 66.667 22.80 4.95 0.00 3.67
2228 2230 3.150949 CCTGTCTGGTCACCTGCA 58.849 61.111 0.00 0.00 0.00 4.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.