Multiple sequence alignment - TraesCS4B01G369500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G369500 chr4B 100.000 2700 0 0 1 2700 655037786 655035087 0.000000e+00 4987.0
1 TraesCS4B01G369500 chr4B 99.259 2700 20 0 1 2700 654926574 654923875 0.000000e+00 4876.0
2 TraesCS4B01G369500 chr4B 99.222 2700 21 0 1 2700 654966919 654964220 0.000000e+00 4870.0
3 TraesCS4B01G369500 chr4B 99.074 2701 24 1 1 2700 655002042 654999342 0.000000e+00 4848.0
4 TraesCS4B01G369500 chr4B 87.861 519 57 6 1900 2415 654709725 654709210 2.970000e-169 604.0
5 TraesCS4B01G369500 chr4B 94.406 286 14 2 2416 2700 655115140 655114856 3.190000e-119 438.0
6 TraesCS4B01G369500 chr4B 94.056 286 16 1 2416 2700 655087161 655086876 1.480000e-117 433.0
7 TraesCS4B01G369500 chr4B 89.825 285 28 1 2416 2700 654709153 654708870 5.490000e-97 364.0
8 TraesCS4B01G369500 chr4B 94.787 211 11 0 2211 2421 655087417 655087207 2.000000e-86 329.0
9 TraesCS4B01G369500 chr4B 75.966 595 73 43 1187 1755 654606900 654606350 2.690000e-60 243.0
10 TraesCS4B01G369500 chr4B 79.940 334 44 16 1245 1562 654810782 654810456 9.730000e-55 224.0
11 TraesCS4B01G369500 chr4B 87.192 203 14 4 1658 1850 654709930 654709730 1.260000e-53 220.0
12 TraesCS4B01G369500 chr4B 88.158 76 8 1 1681 1755 654733798 654733723 3.700000e-14 89.8
13 TraesCS4B01G369500 chr5A 92.413 1094 53 14 563 1655 692262763 692261699 0.000000e+00 1533.0
14 TraesCS4B01G369500 chr5A 88.282 751 75 10 1673 2415 692261432 692260687 0.000000e+00 887.0
15 TraesCS4B01G369500 chr5A 93.506 77 3 2 470 545 551057975 551057900 2.200000e-21 113.0
16 TraesCS4B01G369500 chr5A 90.588 85 2 3 388 472 580445514 580445592 1.020000e-19 108.0
17 TraesCS4B01G369500 chr5A 89.655 87 3 2 386 472 315497949 315497869 3.680000e-19 106.0
18 TraesCS4B01G369500 chrUn 78.093 1657 221 74 840 2410 189565506 189563906 0.000000e+00 918.0
19 TraesCS4B01G369500 chrUn 77.441 1321 162 71 840 2082 154527629 154528891 0.000000e+00 664.0
20 TraesCS4B01G369500 chrUn 83.576 688 87 19 1741 2410 189578275 189577596 2.950000e-174 621.0
21 TraesCS4B01G369500 chrUn 83.357 691 89 19 1738 2410 279540614 279541296 1.370000e-172 616.0
22 TraesCS4B01G369500 chrUn 80.636 692 89 22 1738 2411 358236121 358236785 6.720000e-136 494.0
23 TraesCS4B01G369500 chrUn 76.556 964 131 50 840 1756 201362166 201363081 8.870000e-120 440.0
24 TraesCS4B01G369500 chrUn 77.684 829 112 34 971 1756 291090162 291090960 3.190000e-119 438.0
25 TraesCS4B01G369500 chrUn 77.284 832 110 40 971 1756 154535717 154536515 1.500000e-112 416.0
26 TraesCS4B01G369500 chrUn 76.190 945 134 47 840 1740 201387128 201388025 5.380000e-112 414.0
27 TraesCS4B01G369500 chrUn 77.895 760 93 41 840 1562 60683028 60683749 1.160000e-108 403.0
28 TraesCS4B01G369500 chrUn 75.709 988 129 55 829 1756 154549038 154549974 2.520000e-105 392.0
29 TraesCS4B01G369500 chrUn 77.441 758 100 38 840 1562 413760988 413760267 1.170000e-103 387.0
30 TraesCS4B01G369500 chrUn 77.368 760 97 41 840 1562 413772897 413773618 5.450000e-102 381.0
31 TraesCS4B01G369500 chrUn 77.267 761 99 38 840 1562 416009358 416010082 1.960000e-101 379.0
32 TraesCS4B01G369500 chrUn 84.669 287 36 4 2416 2700 154565950 154566230 2.050000e-71 279.0
33 TraesCS4B01G369500 chrUn 79.904 418 52 20 840 1251 189570619 189570228 7.360000e-71 278.0
34 TraesCS4B01G369500 chrUn 79.665 418 53 20 840 1251 306746328 306745937 3.430000e-69 272.0
35 TraesCS4B01G369500 chrUn 83.916 286 39 3 2416 2700 189563844 189563565 1.590000e-67 267.0
36 TraesCS4B01G369500 chrUn 83.624 287 39 3 2416 2700 346446733 346446453 2.060000e-66 263.0
37 TraesCS4B01G369500 chrUn 78.509 456 48 30 840 1275 221988681 221988256 1.240000e-63 254.0
38 TraesCS4B01G369500 chrUn 76.301 519 81 21 1241 1740 384745864 384746359 3.470000e-59 239.0
39 TraesCS4B01G369500 chrUn 76.108 519 82 21 1241 1740 391869893 391870388 1.620000e-57 233.0
40 TraesCS4B01G369500 chrUn 75.483 518 87 25 1241 1740 201384159 201384654 1.630000e-52 217.0
41 TraesCS4B01G369500 chr1B 91.667 216 16 2 173 387 424378921 424379135 5.650000e-77 298.0
42 TraesCS4B01G369500 chr6D 94.410 161 9 0 1 161 418972568 418972728 5.770000e-62 248.0
43 TraesCS4B01G369500 chr6D 93.789 161 10 0 1 161 144127208 144127368 2.690000e-60 243.0
44 TraesCS4B01G369500 chr6D 93.168 161 11 0 1 161 93579529 93579369 1.250000e-58 237.0
45 TraesCS4B01G369500 chr6D 90.476 84 2 2 388 471 82213120 82213197 3.680000e-19 106.0
46 TraesCS4B01G369500 chr4D 93.789 161 10 0 1 161 41667906 41667746 2.690000e-60 243.0
47 TraesCS4B01G369500 chr4D 93.789 161 10 0 1 161 50611063 50610903 2.690000e-60 243.0
48 TraesCS4B01G369500 chr4D 93.789 161 10 0 1 161 56853109 56852949 2.690000e-60 243.0
49 TraesCS4B01G369500 chr5D 84.615 156 13 7 388 542 544282404 544282259 7.790000e-31 145.0
50 TraesCS4B01G369500 chr5D 90.588 85 2 3 388 472 485164390 485164312 1.020000e-19 108.0
51 TraesCS4B01G369500 chr6B 93.333 75 4 1 472 545 56013713 56013639 2.840000e-20 110.0
52 TraesCS4B01G369500 chr7B 92.208 77 5 1 470 545 608404051 608403975 1.020000e-19 108.0
53 TraesCS4B01G369500 chr7B 93.243 74 4 1 470 542 637304191 637304264 1.020000e-19 108.0
54 TraesCS4B01G369500 chr3B 90.588 85 2 3 388 472 449806778 449806700 1.020000e-19 108.0
55 TraesCS4B01G369500 chr3B 92.208 77 5 1 470 545 690992269 690992193 1.020000e-19 108.0
56 TraesCS4B01G369500 chr2B 83.810 105 10 2 173 270 788870345 788870241 2.860000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G369500 chr4B 655035087 655037786 2699 True 4987.0 4987 100.000000 1 2700 1 chr4B.!!$R7 2699
1 TraesCS4B01G369500 chr4B 654923875 654926574 2699 True 4876.0 4876 99.259000 1 2700 1 chr4B.!!$R4 2699
2 TraesCS4B01G369500 chr4B 654964220 654966919 2699 True 4870.0 4870 99.222000 1 2700 1 chr4B.!!$R5 2699
3 TraesCS4B01G369500 chr4B 654999342 655002042 2700 True 4848.0 4848 99.074000 1 2700 1 chr4B.!!$R6 2699
4 TraesCS4B01G369500 chr4B 654708870 654709930 1060 True 396.0 604 88.292667 1658 2700 3 chr4B.!!$R9 1042
5 TraesCS4B01G369500 chr4B 655086876 655087417 541 True 381.0 433 94.421500 2211 2700 2 chr4B.!!$R10 489
6 TraesCS4B01G369500 chr4B 654606350 654606900 550 True 243.0 243 75.966000 1187 1755 1 chr4B.!!$R1 568
7 TraesCS4B01G369500 chr5A 692260687 692262763 2076 True 1210.0 1533 90.347500 563 2415 2 chr5A.!!$R3 1852
8 TraesCS4B01G369500 chrUn 154527629 154528891 1262 False 664.0 664 77.441000 840 2082 1 chrUn.!!$F2 1242
9 TraesCS4B01G369500 chrUn 189577596 189578275 679 True 621.0 621 83.576000 1741 2410 1 chrUn.!!$R2 669
10 TraesCS4B01G369500 chrUn 279540614 279541296 682 False 616.0 616 83.357000 1738 2410 1 chrUn.!!$F7 672
11 TraesCS4B01G369500 chrUn 189563565 189565506 1941 True 592.5 918 81.004500 840 2700 2 chrUn.!!$R7 1860
12 TraesCS4B01G369500 chrUn 358236121 358236785 664 False 494.0 494 80.636000 1738 2411 1 chrUn.!!$F9 673
13 TraesCS4B01G369500 chrUn 201362166 201363081 915 False 440.0 440 76.556000 840 1756 1 chrUn.!!$F6 916
14 TraesCS4B01G369500 chrUn 291090162 291090960 798 False 438.0 438 77.684000 971 1756 1 chrUn.!!$F8 785
15 TraesCS4B01G369500 chrUn 154535717 154536515 798 False 416.0 416 77.284000 971 1756 1 chrUn.!!$F3 785
16 TraesCS4B01G369500 chrUn 60683028 60683749 721 False 403.0 403 77.895000 840 1562 1 chrUn.!!$F1 722
17 TraesCS4B01G369500 chrUn 154549038 154549974 936 False 392.0 392 75.709000 829 1756 1 chrUn.!!$F4 927
18 TraesCS4B01G369500 chrUn 413760267 413760988 721 True 387.0 387 77.441000 840 1562 1 chrUn.!!$R6 722
19 TraesCS4B01G369500 chrUn 413772897 413773618 721 False 381.0 381 77.368000 840 1562 1 chrUn.!!$F12 722
20 TraesCS4B01G369500 chrUn 416009358 416010082 724 False 379.0 379 77.267000 840 1562 1 chrUn.!!$F13 722
21 TraesCS4B01G369500 chrUn 201384159 201388025 3866 False 315.5 414 75.836500 840 1740 2 chrUn.!!$F14 900

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1164 3307 1.66783 CTCCATCGTGCACGGTTGT 60.668 57.895 36.41 18.62 40.29 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2390 4951 1.002868 CAGGCTCTGGGTGAGGTTG 60.003 63.158 0.0 0.0 42.87 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1164 3307 1.667830 CTCCATCGTGCACGGTTGT 60.668 57.895 36.41 18.62 40.29 3.32
1720 4185 7.537306 CGTGGAATAAAAGTATGTTGAAGTTGG 59.463 37.037 0.00 0.00 0.00 3.77
2203 4761 4.452825 ACTCTCTTTGAGATGATGCATGG 58.547 43.478 2.46 0.00 45.39 3.66
2390 4951 2.047179 GCGGACTCCAACACCCTC 60.047 66.667 0.00 0.00 0.00 4.30
2446 5063 0.320683 TGACCATGCCTTGACAGACG 60.321 55.000 0.00 0.00 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 151 8.724310 AGATACTAGGCTACACCCAATATTTTT 58.276 33.333 0.00 0.0 40.58 1.94
743 745 2.038837 GCGGGGCCAAGTCAACTAC 61.039 63.158 4.39 0.0 0.00 2.73
1235 3423 3.545124 GATGGTGGTGGCGGTGACA 62.545 63.158 0.00 0.0 0.00 3.58
1335 3523 1.097547 GCTGGCAGCACGGTTCATAT 61.098 55.000 33.33 0.0 41.89 1.78
2041 4587 9.077885 AGTTCAAACACATTACCATTTATGAGT 57.922 29.630 0.00 0.0 0.00 3.41
2203 4761 3.380637 TGAAGATGCCCTTACGAGTAGAC 59.619 47.826 0.00 0.0 34.68 2.59
2390 4951 1.002868 CAGGCTCTGGGTGAGGTTG 60.003 63.158 0.00 0.0 42.87 3.77
2446 5063 1.424493 GCATGTGTAGAGCGGCAGAC 61.424 60.000 1.45 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.