Multiple sequence alignment - TraesCS4B01G369400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G369400 chr4B 100.000 2405 0 0 1 2405 654966826 654964422 0.000000e+00 4442.0
1 TraesCS4B01G369400 chr4B 99.667 2405 8 0 1 2405 654926481 654924077 0.000000e+00 4397.0
2 TraesCS4B01G369400 chr4B 99.460 2406 12 1 1 2405 655001949 654999544 0.000000e+00 4370.0
3 TraesCS4B01G369400 chr4B 99.210 2405 19 0 1 2405 655037693 655035289 0.000000e+00 4337.0
4 TraesCS4B01G369400 chr4B 88.247 519 55 6 1807 2322 654709725 654709210 1.220000e-172 616.0
5 TraesCS4B01G369400 chr4B 95.261 211 10 0 2118 2328 655087417 655087207 3.830000e-88 335.0
6 TraesCS4B01G369400 chr4B 76.263 594 73 36 1094 1662 654606900 654606350 1.100000e-63 254.0
7 TraesCS4B01G369400 chr4B 80.180 333 45 9 1152 1469 654810782 654810456 1.860000e-56 230.0
8 TraesCS4B01G369400 chr4B 87.685 203 13 4 1565 1757 654709930 654709730 2.410000e-55 226.0
9 TraesCS4B01G369400 chr4B 96.386 83 2 1 2323 2404 655115140 655115058 4.170000e-28 135.0
10 TraesCS4B01G369400 chr4B 92.857 84 5 1 2323 2405 655087161 655087078 1.170000e-23 121.0
11 TraesCS4B01G369400 chr4B 94.118 68 4 0 1 68 563912797 563912864 1.180000e-18 104.0
12 TraesCS4B01G369400 chr4B 91.892 74 5 1 377 449 538389571 538389644 4.230000e-18 102.0
13 TraesCS4B01G369400 chr4B 87.952 83 10 0 2323 2405 654709153 654709071 5.470000e-17 99.0
14 TraesCS4B01G369400 chr4B 89.474 76 7 1 1588 1662 654733798 654733723 7.080000e-16 95.3
15 TraesCS4B01G369400 chr4B 87.838 74 7 2 377 449 438598448 438598520 4.260000e-13 86.1
16 TraesCS4B01G369400 chr5A 92.779 1094 49 14 470 1562 692262763 692261699 0.000000e+00 1555.0
17 TraesCS4B01G369400 chr5A 88.549 751 73 11 1580 2322 692261432 692260687 0.000000e+00 898.0
18 TraesCS4B01G369400 chr5A 94.805 77 2 2 377 452 551057975 551057900 4.200000e-23 119.0
19 TraesCS4B01G369400 chr5A 89.412 85 3 3 295 379 580445514 580445592 4.230000e-18 102.0
20 TraesCS4B01G369400 chr5A 88.506 87 4 2 293 379 315497949 315497869 1.520000e-17 100.0
21 TraesCS4B01G369400 chr5A 89.286 84 3 2 296 379 522113926 522113849 1.520000e-17 100.0
22 TraesCS4B01G369400 chrUn 78.140 1656 222 71 747 2317 189565506 189563906 0.000000e+00 924.0
23 TraesCS4B01G369400 chrUn 77.593 1321 160 70 747 1989 154527629 154528891 0.000000e+00 675.0
24 TraesCS4B01G369400 chrUn 83.721 688 86 19 1648 2317 189578275 189577596 5.640000e-176 627.0
25 TraesCS4B01G369400 chrUn 83.502 691 88 19 1645 2317 279540614 279541296 2.630000e-174 621.0
26 TraesCS4B01G369400 chrUn 80.780 692 88 22 1645 2318 358236121 358236785 1.280000e-137 499.0
27 TraesCS4B01G369400 chrUn 77.831 830 109 32 878 1663 291090162 291090960 6.100000e-121 444.0
28 TraesCS4B01G369400 chrUn 77.807 757 99 36 747 1469 60683028 60683749 1.040000e-108 403.0
29 TraesCS4B01G369400 chrUn 75.808 959 126 54 747 1647 384745449 384746359 2.900000e-104 388.0
30 TraesCS4B01G369400 chrUn 75.808 959 126 54 747 1647 391869478 391870388 2.900000e-104 388.0
31 TraesCS4B01G369400 chrUn 77.411 757 102 36 747 1469 413760988 413760267 1.040000e-103 387.0
32 TraesCS4B01G369400 chrUn 77.279 757 103 36 747 1469 413772897 413773618 4.850000e-102 381.0
33 TraesCS4B01G369400 chrUn 77.237 760 101 35 747 1469 416009358 416010082 1.740000e-101 379.0
34 TraesCS4B01G369400 chrUn 80.144 418 51 20 747 1158 189570619 189570228 1.410000e-72 283.0
35 TraesCS4B01G369400 chrUn 79.904 418 52 20 747 1158 306746328 306745937 6.550000e-71 278.0
36 TraesCS4B01G369400 chrUn 79.118 431 53 21 736 1158 154549038 154549439 1.830000e-66 263.0
37 TraesCS4B01G369400 chrUn 78.634 454 51 27 747 1182 221988681 221988256 2.370000e-65 259.0
38 TraesCS4B01G369400 chrUn 95.588 68 3 0 1 68 150651422 150651489 2.530000e-20 110.0
39 TraesCS4B01G369400 chrUn 95.588 68 3 0 1 68 150747509 150747576 2.530000e-20 110.0
40 TraesCS4B01G369400 chr1B 91.204 216 17 2 80 294 424378921 424379135 2.340000e-75 292.0
41 TraesCS4B01G369400 chr1B 95.588 68 3 0 1 68 183840348 183840415 2.530000e-20 110.0
42 TraesCS4B01G369400 chr5D 84.615 156 13 7 295 449 544282404 544282259 6.930000e-31 145.0
43 TraesCS4B01G369400 chr3B 94.872 78 3 1 376 452 618032066 618031989 1.170000e-23 121.0
44 TraesCS4B01G369400 chr3B 93.506 77 4 1 377 452 690992269 690992193 1.950000e-21 113.0
45 TraesCS4B01G369400 chr3B 89.412 85 3 2 295 379 449806778 449806700 4.230000e-18 102.0
46 TraesCS4B01G369400 chr4A 92.683 82 4 2 372 452 621853005 621852925 1.510000e-22 117.0
47 TraesCS4B01G369400 chr4A 91.892 74 5 1 377 449 664934234 664934307 4.230000e-18 102.0
48 TraesCS4B01G369400 chr6B 94.667 75 3 1 379 452 56013713 56013639 5.430000e-22 115.0
49 TraesCS4B01G369400 chr7B 94.595 74 3 1 377 449 637304191 637304264 1.950000e-21 113.0
50 TraesCS4B01G369400 chr7B 92.208 77 5 1 377 452 608404051 608403975 9.090000e-20 108.0
51 TraesCS4B01G369400 chr3D 93.506 77 3 2 377 452 21444182 21444107 1.950000e-21 113.0
52 TraesCS4B01G369400 chr3D 91.892 74 5 1 380 452 565969345 565969272 4.230000e-18 102.0
53 TraesCS4B01G369400 chr6A 93.243 74 4 1 380 452 558151913 558151840 9.090000e-20 108.0
54 TraesCS4B01G369400 chr6A 92.537 67 3 1 378 442 521859497 521859431 7.080000e-16 95.3
55 TraesCS4B01G369400 chr3A 92.958 71 5 0 1 71 395737664 395737594 1.180000e-18 104.0
56 TraesCS4B01G369400 chr2B 92.958 71 5 0 1 71 618913953 618913883 1.180000e-18 104.0
57 TraesCS4B01G369400 chr6D 94.118 68 3 1 377 443 386280647 386280714 4.230000e-18 102.0
58 TraesCS4B01G369400 chr6D 89.286 84 3 2 295 378 82213120 82213197 1.520000e-17 100.0
59 TraesCS4B01G369400 chr1A 88.158 76 7 2 372 446 588685235 588685161 3.290000e-14 89.8
60 TraesCS4B01G369400 chr1A 87.838 74 8 1 377 449 297254319 297254246 4.260000e-13 86.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G369400 chr4B 654964422 654966826 2404 True 4442.000000 4442 100.000000 1 2405 1 chr4B.!!$R5 2404
1 TraesCS4B01G369400 chr4B 654924077 654926481 2404 True 4397.000000 4397 99.667000 1 2405 1 chr4B.!!$R4 2404
2 TraesCS4B01G369400 chr4B 654999544 655001949 2405 True 4370.000000 4370 99.460000 1 2405 1 chr4B.!!$R6 2404
3 TraesCS4B01G369400 chr4B 655035289 655037693 2404 True 4337.000000 4337 99.210000 1 2405 1 chr4B.!!$R7 2404
4 TraesCS4B01G369400 chr4B 654709071 654709930 859 True 313.666667 616 87.961333 1565 2405 3 chr4B.!!$R9 840
5 TraesCS4B01G369400 chr4B 654606350 654606900 550 True 254.000000 254 76.263000 1094 1662 1 chr4B.!!$R1 568
6 TraesCS4B01G369400 chr5A 692260687 692262763 2076 True 1226.500000 1555 90.664000 470 2322 2 chr5A.!!$R4 1852
7 TraesCS4B01G369400 chrUn 189563906 189565506 1600 True 924.000000 924 78.140000 747 2317 1 chrUn.!!$R1 1570
8 TraesCS4B01G369400 chrUn 154527629 154528891 1262 False 675.000000 675 77.593000 747 1989 1 chrUn.!!$F4 1242
9 TraesCS4B01G369400 chrUn 189577596 189578275 679 True 627.000000 627 83.721000 1648 2317 1 chrUn.!!$R3 669
10 TraesCS4B01G369400 chrUn 279540614 279541296 682 False 621.000000 621 83.502000 1645 2317 1 chrUn.!!$F6 672
11 TraesCS4B01G369400 chrUn 358236121 358236785 664 False 499.000000 499 80.780000 1645 2318 1 chrUn.!!$F8 673
12 TraesCS4B01G369400 chrUn 291090162 291090960 798 False 444.000000 444 77.831000 878 1663 1 chrUn.!!$F7 785
13 TraesCS4B01G369400 chrUn 60683028 60683749 721 False 403.000000 403 77.807000 747 1469 1 chrUn.!!$F1 722
14 TraesCS4B01G369400 chrUn 384745449 384746359 910 False 388.000000 388 75.808000 747 1647 1 chrUn.!!$F9 900
15 TraesCS4B01G369400 chrUn 391869478 391870388 910 False 388.000000 388 75.808000 747 1647 1 chrUn.!!$F10 900
16 TraesCS4B01G369400 chrUn 413760267 413760988 721 True 387.000000 387 77.411000 747 1469 1 chrUn.!!$R6 722
17 TraesCS4B01G369400 chrUn 413772897 413773618 721 False 381.000000 381 77.279000 747 1469 1 chrUn.!!$F11 722
18 TraesCS4B01G369400 chrUn 416009358 416010082 724 False 379.000000 379 77.237000 747 1469 1 chrUn.!!$F12 722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
599 601 1.369855 ATCCGGGGGAGGCTACTACT 61.37 60.0 0.0 0.0 34.05 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2038 2475 3.716601 GTGGAAACCATGTTTGGAAGTG 58.283 45.455 0.0 0.0 46.92 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
370 371 9.774742 GCTTATCATCTTGAAATTTACGAAGTT 57.225 29.63 0.0 0.0 37.78 2.66
599 601 1.369855 ATCCGGGGGAGGCTACTACT 61.370 60.00 0.0 0.0 34.05 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
370 371 4.921515 GTGCTCGCATTTATTCCTACGATA 59.078 41.667 0.00 0.00 0.00 2.92
599 601 4.580868 TCCTCATACGTGGCACAAAATTA 58.419 39.130 19.09 0.61 44.16 1.40
2038 2475 3.716601 GTGGAAACCATGTTTGGAAGTG 58.283 45.455 0.00 0.00 46.92 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.