Multiple sequence alignment - TraesCS4B01G368800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G368800 chr4B 100.000 2789 0 0 1 2789 654775590 654772802 0.000000e+00 5151.0
1 TraesCS4B01G368800 chr4B 98.533 2794 35 3 1 2789 654763383 654760591 0.000000e+00 4927.0
2 TraesCS4B01G368800 chr4B 98.533 2794 34 3 1 2789 654753143 654750352 0.000000e+00 4926.0
3 TraesCS4B01G368800 chr4B 96.000 2025 72 8 771 2789 654699879 654697858 0.000000e+00 3282.0
4 TraesCS4B01G368800 chr4B 98.868 1148 12 1 1 1148 654643976 654642830 0.000000e+00 2047.0
5 TraesCS4B01G368800 chr4B 84.023 2128 245 48 609 2696 654603638 654601566 0.000000e+00 1958.0
6 TraesCS4B01G368800 chr4B 96.635 1159 38 1 1632 2789 654634194 654633036 0.000000e+00 1923.0
7 TraesCS4B01G368800 chr4B 82.922 1985 222 59 753 2696 654728870 654726962 0.000000e+00 1679.0
8 TraesCS4B01G368800 chr4B 87.523 1082 94 18 609 1684 655059645 655058599 0.000000e+00 1212.0
9 TraesCS4B01G368800 chr4B 85.523 1043 98 21 648 1684 655092709 655091714 0.000000e+00 1040.0
10 TraesCS4B01G368800 chr5A 91.388 1045 75 11 37 1072 692206870 692205832 0.000000e+00 1417.0
11 TraesCS4B01G368800 chr5A 85.106 94 10 2 1740 1829 692163025 692162932 2.960000e-15 93.5
12 TraesCS4B01G368800 chrUn 92.045 968 67 8 37 997 189559483 189558519 0.000000e+00 1352.0
13 TraesCS4B01G368800 chrUn 91.839 968 68 8 37 997 363555426 363556389 0.000000e+00 1339.0
14 TraesCS4B01G368800 chrUn 91.839 968 68 8 37 997 363567177 363566214 0.000000e+00 1339.0
15 TraesCS4B01G368800 chrUn 91.736 968 69 8 37 997 363526637 363525674 0.000000e+00 1334.0
16 TraesCS4B01G368800 chrUn 89.137 672 61 7 1002 1665 189558348 189557681 0.000000e+00 826.0
17 TraesCS4B01G368800 chrUn 88.596 684 66 7 990 1665 154546022 154546701 0.000000e+00 821.0
18 TraesCS4B01G368800 chrUn 89.375 640 58 6 1002 1633 363566043 363565406 0.000000e+00 797.0
19 TraesCS4B01G368800 chrUn 90.597 553 47 3 37 587 159525006 159524457 0.000000e+00 728.0
20 TraesCS4B01G368800 chrUn 98.044 409 8 0 1813 2221 477840581 477840173 0.000000e+00 712.0
21 TraesCS4B01G368800 chrUn 81.720 93 12 3 1740 1828 154630360 154630451 3.850000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G368800 chr4B 654772802 654775590 2788 True 5151 5151 100.000 1 2789 1 chr4B.!!$R8 2788
1 TraesCS4B01G368800 chr4B 654760591 654763383 2792 True 4927 4927 98.533 1 2789 1 chr4B.!!$R7 2788
2 TraesCS4B01G368800 chr4B 654750352 654753143 2791 True 4926 4926 98.533 1 2789 1 chr4B.!!$R6 2788
3 TraesCS4B01G368800 chr4B 654697858 654699879 2021 True 3282 3282 96.000 771 2789 1 chr4B.!!$R4 2018
4 TraesCS4B01G368800 chr4B 654642830 654643976 1146 True 2047 2047 98.868 1 1148 1 chr4B.!!$R3 1147
5 TraesCS4B01G368800 chr4B 654601566 654603638 2072 True 1958 1958 84.023 609 2696 1 chr4B.!!$R1 2087
6 TraesCS4B01G368800 chr4B 654633036 654634194 1158 True 1923 1923 96.635 1632 2789 1 chr4B.!!$R2 1157
7 TraesCS4B01G368800 chr4B 654726962 654728870 1908 True 1679 1679 82.922 753 2696 1 chr4B.!!$R5 1943
8 TraesCS4B01G368800 chr4B 655058599 655059645 1046 True 1212 1212 87.523 609 1684 1 chr4B.!!$R9 1075
9 TraesCS4B01G368800 chr4B 655091714 655092709 995 True 1040 1040 85.523 648 1684 1 chr4B.!!$R10 1036
10 TraesCS4B01G368800 chr5A 692205832 692206870 1038 True 1417 1417 91.388 37 1072 1 chr5A.!!$R2 1035
11 TraesCS4B01G368800 chrUn 363555426 363556389 963 False 1339 1339 91.839 37 997 1 chrUn.!!$F3 960
12 TraesCS4B01G368800 chrUn 363525674 363526637 963 True 1334 1334 91.736 37 997 1 chrUn.!!$R2 960
13 TraesCS4B01G368800 chrUn 189557681 189559483 1802 True 1089 1352 90.591 37 1665 2 chrUn.!!$R4 1628
14 TraesCS4B01G368800 chrUn 363565406 363567177 1771 True 1068 1339 90.607 37 1633 2 chrUn.!!$R5 1596
15 TraesCS4B01G368800 chrUn 154546022 154546701 679 False 821 821 88.596 990 1665 1 chrUn.!!$F1 675
16 TraesCS4B01G368800 chrUn 159524457 159525006 549 True 728 728 90.597 37 587 1 chrUn.!!$R1 550

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
551 558 1.604593 GCACAACCACTGCCCAGAT 60.605 57.895 1.69 0.0 0.0 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1920 2181 1.781555 CGAGTTGCTGCGGTTGTAG 59.218 57.895 0.0 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
551 558 1.604593 GCACAACCACTGCCCAGAT 60.605 57.895 1.69 0.0 0.00 2.90
1605 1815 0.320334 ATGCATCGTCGTGGTCACAA 60.320 50.000 0.00 0.0 0.00 3.33
1700 1957 9.737427 CACACTCGTCATTTATAAGATACTCTT 57.263 33.333 0.00 0.0 40.35 2.85
1959 2220 3.059665 CGCTTGGCATGGTTTTCTTTTTC 60.060 43.478 2.33 0.0 0.00 2.29
2130 2391 6.533367 TGTTGCAACACTTTGACCTAAATTTC 59.467 34.615 27.96 0.0 34.24 2.17
2179 2445 9.691362 AATTTTAACTTCACAATTTCACGCTAT 57.309 25.926 0.00 0.0 0.00 2.97
2217 2483 2.807967 CAGATCGCTTTTGACAGTTGGA 59.192 45.455 0.00 0.0 0.00 3.53
2251 2519 4.142038 AGGTCAAGCTAAAACCGTTCATT 58.858 39.130 6.47 0.0 38.14 2.57
2370 2642 4.655762 AGTCATTTAGCATCGTCTAGCA 57.344 40.909 0.00 0.0 0.00 3.49
2562 2852 0.550914 TTGGATCCTTTCGATGGGGG 59.449 55.000 14.23 0.0 0.00 5.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1605 1815 1.806542 GACATGCAAACCAGTGACGAT 59.193 47.619 0.00 0.00 0.00 3.73
1700 1957 5.816777 TCATATCGAAATGCAGTGATCAACA 59.183 36.000 0.00 0.00 0.00 3.33
1920 2181 1.781555 CGAGTTGCTGCGGTTGTAG 59.218 57.895 0.00 0.00 0.00 2.74
1959 2220 5.689383 TTGTGGTTCTGCTTAAGCTTAAG 57.311 39.130 32.86 32.86 42.30 1.85
2099 2360 4.362279 GTCAAAGTGTTGCAACATCACAT 58.638 39.130 33.16 16.12 41.59 3.21
2179 2445 5.004448 CGATCTGGTCAGCCTATTCTAGTA 58.996 45.833 0.00 0.00 35.27 1.82
2217 2483 2.169352 AGCTTGACCTATTGCACGAGAT 59.831 45.455 0.00 0.00 0.00 2.75
2251 2519 6.459923 GGCCAAATTTTACTTTATGGACACA 58.540 36.000 0.00 0.00 35.97 3.72
2370 2642 7.586349 TGCTTATTCCTTCAGGGATTTATCTT 58.414 34.615 0.00 0.00 44.66 2.40
2390 2662 4.020839 GGTACTCCAACCAGTTACTGCTTA 60.021 45.833 6.88 0.00 39.50 3.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.