Multiple sequence alignment - TraesCS4B01G368700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G368700 chr4B 100.000 2438 0 0 1 2438 654763272 654760835 0.000000e+00 4503.0
1 TraesCS4B01G368700 chr4B 99.303 2438 16 1 1 2438 654753032 654750596 0.000000e+00 4407.0
2 TraesCS4B01G368700 chr4B 98.524 2439 30 3 1 2438 654775479 654773046 0.000000e+00 4300.0
3 TraesCS4B01G368700 chr4B 95.742 1785 64 7 659 2438 654699879 654698102 0.000000e+00 2865.0
4 TraesCS4B01G368700 chr4B 84.394 1980 209 46 497 2436 654603638 654601719 0.000000e+00 1853.0
5 TraesCS4B01G368700 chr4B 98.361 1037 15 2 1 1036 654643865 654642830 0.000000e+00 1820.0
6 TraesCS4B01G368700 chr4B 83.179 1837 187 57 641 2436 654728870 654727115 0.000000e+00 1568.0
7 TraesCS4B01G368700 chr4B 97.062 919 23 1 1520 2438 654634194 654633280 0.000000e+00 1544.0
8 TraesCS4B01G368700 chr4B 87.431 1082 95 18 497 1572 655059645 655058599 0.000000e+00 1206.0
9 TraesCS4B01G368700 chr4B 85.618 1043 97 21 536 1572 655092709 655091714 0.000000e+00 1046.0
10 TraesCS4B01G368700 chr5A 91.417 967 69 9 3 960 692206793 692205832 0.000000e+00 1314.0
11 TraesCS4B01G368700 chr5A 84.043 94 11 2 1628 1717 692163025 692162932 1.200000e-13 87.9
12 TraesCS4B01G368700 chrUn 92.551 886 57 7 7 885 189559402 189558519 0.000000e+00 1262.0
13 TraesCS4B01G368700 chrUn 92.325 886 58 8 7 885 363555507 363556389 0.000000e+00 1251.0
14 TraesCS4B01G368700 chrUn 92.325 886 58 8 7 885 363567096 363566214 0.000000e+00 1251.0
15 TraesCS4B01G368700 chrUn 92.212 886 59 8 7 885 363526556 363525674 0.000000e+00 1245.0
16 TraesCS4B01G368700 chrUn 89.435 672 59 7 890 1553 189558348 189557681 0.000000e+00 837.0
17 TraesCS4B01G368700 chrUn 88.889 684 64 7 878 1553 154546022 154546701 0.000000e+00 832.0
18 TraesCS4B01G368700 chrUn 89.688 640 56 6 890 1521 363566043 363565406 0.000000e+00 808.0
19 TraesCS4B01G368700 chrUn 100.000 409 0 0 1701 2109 477840581 477840173 0.000000e+00 756.0
20 TraesCS4B01G368700 chrUn 89.895 475 44 3 3 475 159524929 159524457 2.070000e-170 608.0
21 TraesCS4B01G368700 chrUn 85.455 275 35 4 1909 2181 154572577 154572848 5.130000e-72 281.0
22 TraesCS4B01G368700 chrUn 89.474 57 4 2 1628 1683 154630360 154630415 1.210000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G368700 chr4B 654760835 654763272 2437 True 4503.0 4503 100.0000 1 2438 1 chr4B.!!$R7 2437
1 TraesCS4B01G368700 chr4B 654750596 654753032 2436 True 4407.0 4407 99.3030 1 2438 1 chr4B.!!$R6 2437
2 TraesCS4B01G368700 chr4B 654773046 654775479 2433 True 4300.0 4300 98.5240 1 2438 1 chr4B.!!$R8 2437
3 TraesCS4B01G368700 chr4B 654698102 654699879 1777 True 2865.0 2865 95.7420 659 2438 1 chr4B.!!$R4 1779
4 TraesCS4B01G368700 chr4B 654601719 654603638 1919 True 1853.0 1853 84.3940 497 2436 1 chr4B.!!$R1 1939
5 TraesCS4B01G368700 chr4B 654642830 654643865 1035 True 1820.0 1820 98.3610 1 1036 1 chr4B.!!$R3 1035
6 TraesCS4B01G368700 chr4B 654727115 654728870 1755 True 1568.0 1568 83.1790 641 2436 1 chr4B.!!$R5 1795
7 TraesCS4B01G368700 chr4B 654633280 654634194 914 True 1544.0 1544 97.0620 1520 2438 1 chr4B.!!$R2 918
8 TraesCS4B01G368700 chr4B 655058599 655059645 1046 True 1206.0 1206 87.4310 497 1572 1 chr4B.!!$R9 1075
9 TraesCS4B01G368700 chr4B 655091714 655092709 995 True 1046.0 1046 85.6180 536 1572 1 chr4B.!!$R10 1036
10 TraesCS4B01G368700 chr5A 692205832 692206793 961 True 1314.0 1314 91.4170 3 960 1 chr5A.!!$R2 957
11 TraesCS4B01G368700 chrUn 363555507 363556389 882 False 1251.0 1251 92.3250 7 885 1 chrUn.!!$F4 878
12 TraesCS4B01G368700 chrUn 363525674 363526556 882 True 1245.0 1245 92.2120 7 885 1 chrUn.!!$R2 878
13 TraesCS4B01G368700 chrUn 189557681 189559402 1721 True 1049.5 1262 90.9930 7 1553 2 chrUn.!!$R4 1546
14 TraesCS4B01G368700 chrUn 363565406 363567096 1690 True 1029.5 1251 91.0065 7 1521 2 chrUn.!!$R5 1514
15 TraesCS4B01G368700 chrUn 154546022 154546701 679 False 832.0 832 88.8890 878 1553 1 chrUn.!!$F1 675

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
437 445 0.179004 CCAGCACAACCACTACCCAA 60.179 55.0 0.0 0.0 0.0 4.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1699 1945 3.746492 GGCAATATATCACGGGTTCAGTC 59.254 47.826 0.0 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 163 9.280174 TGGCATACTATTACCTAACATAAAAGC 57.720 33.333 0.0 0.0 0.0 3.51
432 440 1.993956 ATTTGCCAGCACAACCACTA 58.006 45.000 0.0 0.0 0.0 2.74
437 445 0.179004 CCAGCACAACCACTACCCAA 60.179 55.000 0.0 0.0 0.0 4.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 163 1.397343 TCGCGCACTCTCAGTACTAAG 59.603 52.381 8.75 0.0 0.00 2.18
1699 1945 3.746492 GGCAATATATCACGGGTTCAGTC 59.254 47.826 0.00 0.0 0.00 3.51
2267 2524 5.474876 CAGTTAATTGCTTCTTCCTTCAGGT 59.525 40.000 0.00 0.0 36.34 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.