Multiple sequence alignment - TraesCS4B01G360300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G360300 chr4B 100.000 3931 0 0 1 3931 650530551 650526621 0.000000e+00 7223.0
1 TraesCS4B01G360300 chr4B 99.020 3162 28 2 773 3931 650409595 650406434 0.000000e+00 5664.0
2 TraesCS4B01G360300 chr4B 98.728 2674 31 2 1069 3739 650504348 650501675 0.000000e+00 4761.0
3 TraesCS4B01G360300 chr4B 99.687 1599 5 0 1538 3136 650489208 650487610 0.000000e+00 2926.0
4 TraesCS4B01G360300 chr4B 96.918 1655 49 2 1618 3272 650456939 650455287 0.000000e+00 2772.0
5 TraesCS4B01G360300 chr4B 99.344 762 5 0 1 762 650505161 650504400 0.000000e+00 1380.0
6 TraesCS4B01G360300 chr4B 99.213 762 6 0 1 762 650491337 650490576 0.000000e+00 1375.0
7 TraesCS4B01G360300 chr4B 98.819 762 9 0 1 762 650410418 650409657 0.000000e+00 1358.0
8 TraesCS4B01G360300 chr4B 96.287 781 27 2 773 1552 650457723 650456944 0.000000e+00 1280.0
9 TraesCS4B01G360300 chr4B 91.841 527 30 7 124 640 650458391 650457868 0.000000e+00 723.0
10 TraesCS4B01G360300 chr4B 98.361 122 2 0 3810 3931 650501548 650501427 8.560000e-52 215.0
11 TraesCS4B01G360300 chr4B 96.226 53 2 0 710 762 650457831 650457779 1.950000e-13 87.9
12 TraesCS4B01G360300 chr4D 97.331 2510 56 2 773 3272 503999647 503997139 0.000000e+00 4253.0
13 TraesCS4B01G360300 chr4D 95.579 769 23 6 1 762 504000695 503999931 0.000000e+00 1221.0
14 TraesCS4B01G360300 chr4D 96.034 353 11 2 3286 3635 409498324 409498676 4.410000e-159 571.0
15 TraesCS4B01G360300 chrUn 82.375 2366 335 54 910 3224 110472031 110474365 0.000000e+00 1984.0
16 TraesCS4B01G360300 chrUn 99.432 1056 5 1 2621 3675 264767441 264766386 0.000000e+00 1916.0
17 TraesCS4B01G360300 chrUn 97.656 128 3 0 1 128 303840398 303840525 1.840000e-53 220.0
18 TraesCS4B01G360300 chrUn 97.656 128 3 0 1 128 311150928 311151055 1.840000e-53 220.0
19 TraesCS4B01G360300 chrUn 96.907 97 3 0 3835 3931 356364761 356364665 3.140000e-36 163.0
20 TraesCS4B01G360300 chr5D 89.308 1113 119 0 1799 2911 5275057 5273945 0.000000e+00 1397.0
21 TraesCS4B01G360300 chr5D 85.084 838 110 13 774 1601 5275942 5275110 0.000000e+00 841.0
22 TraesCS4B01G360300 chr5B 89.068 1116 122 0 1796 2911 6624778 6625893 0.000000e+00 1386.0
23 TraesCS4B01G360300 chr5B 85.444 845 107 14 774 1607 6623897 6624736 0.000000e+00 865.0
24 TraesCS4B01G360300 chr5B 89.623 106 9 2 3121 3224 6625951 6626056 2.460000e-27 134.0
25 TraesCS4B01G360300 chr5B 89.583 48 3 2 716 762 31141264 31141310 4.240000e-05 60.2
26 TraesCS4B01G360300 chr5A 82.792 1569 226 29 1669 3224 700177081 700175544 0.000000e+00 1362.0
27 TraesCS4B01G360300 chr5A 85.259 848 109 13 774 1609 3505691 3506534 0.000000e+00 859.0
28 TraesCS4B01G360300 chr5A 84.426 610 89 1 890 1499 3618261 3617658 2.610000e-166 595.0
29 TraesCS4B01G360300 chr5A 82.781 151 23 2 3111 3259 3614996 3614847 8.860000e-27 132.0
30 TraesCS4B01G360300 chr5A 79.167 96 12 6 412 505 3620750 3620661 4.240000e-05 60.2
31 TraesCS4B01G360300 chr2B 96.296 351 12 1 3286 3635 170350370 170350020 3.410000e-160 575.0
32 TraesCS4B01G360300 chr2B 95.726 351 14 1 3286 3635 117978555 117978205 7.370000e-157 564.0
33 TraesCS4B01G360300 chr2B 94.231 52 0 3 3646 3697 139864940 139864892 4.210000e-10 76.8
34 TraesCS4B01G360300 chr1B 96.011 351 13 1 3286 3635 687569387 687569037 1.580000e-158 569.0
35 TraesCS4B01G360300 chr1B 95.751 353 13 2 3283 3633 19417367 19417719 5.700000e-158 568.0
36 TraesCS4B01G360300 chr1B 95.726 351 14 1 3286 3635 224177890 224178240 7.370000e-157 564.0
37 TraesCS4B01G360300 chr1B 98.113 53 1 0 3646 3698 161298989 161299041 4.180000e-15 93.5
38 TraesCS4B01G360300 chr1B 94.118 51 1 2 3646 3696 346291785 346291737 4.210000e-10 76.8
39 TraesCS4B01G360300 chr6A 97.656 128 3 0 1 128 364083304 364083177 1.840000e-53 220.0
40 TraesCS4B01G360300 chr1A 97.656 128 3 0 1 128 24566519 24566392 1.840000e-53 220.0
41 TraesCS4B01G360300 chr3B 94.928 138 6 1 1 138 556054381 556054517 8.560000e-52 215.0
42 TraesCS4B01G360300 chr3B 94.928 138 6 1 1 138 810122474 810122338 8.560000e-52 215.0
43 TraesCS4B01G360300 chr3B 96.154 52 2 0 3646 3697 312360607 312360658 7.000000e-13 86.1
44 TraesCS4B01G360300 chr3B 94.000 50 2 1 3646 3695 354323539 354323587 1.510000e-09 75.0
45 TraesCS4B01G360300 chr7B 100.000 45 0 0 3646 3690 369157115 369157071 2.520000e-12 84.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G360300 chr4B 650526621 650530551 3930 True 7223.000000 7223 100.000000 1 3931 1 chr4B.!!$R1 3930
1 TraesCS4B01G360300 chr4B 650406434 650410418 3984 True 3511.000000 5664 98.919500 1 3931 2 chr4B.!!$R2 3930
2 TraesCS4B01G360300 chr4B 650487610 650491337 3727 True 2150.500000 2926 99.450000 1 3136 2 chr4B.!!$R4 3135
3 TraesCS4B01G360300 chr4B 650501427 650505161 3734 True 2118.666667 4761 98.811000 1 3931 3 chr4B.!!$R5 3930
4 TraesCS4B01G360300 chr4B 650455287 650458391 3104 True 1215.725000 2772 95.318000 124 3272 4 chr4B.!!$R3 3148
5 TraesCS4B01G360300 chr4D 503997139 504000695 3556 True 2737.000000 4253 96.455000 1 3272 2 chr4D.!!$R1 3271
6 TraesCS4B01G360300 chrUn 110472031 110474365 2334 False 1984.000000 1984 82.375000 910 3224 1 chrUn.!!$F1 2314
7 TraesCS4B01G360300 chrUn 264766386 264767441 1055 True 1916.000000 1916 99.432000 2621 3675 1 chrUn.!!$R1 1054
8 TraesCS4B01G360300 chr5D 5273945 5275942 1997 True 1119.000000 1397 87.196000 774 2911 2 chr5D.!!$R1 2137
9 TraesCS4B01G360300 chr5B 6623897 6626056 2159 False 795.000000 1386 88.045000 774 3224 3 chr5B.!!$F2 2450
10 TraesCS4B01G360300 chr5A 700175544 700177081 1537 True 1362.000000 1362 82.792000 1669 3224 1 chr5A.!!$R1 1555
11 TraesCS4B01G360300 chr5A 3505691 3506534 843 False 859.000000 859 85.259000 774 1609 1 chr5A.!!$F1 835
12 TraesCS4B01G360300 chr5A 3614847 3620750 5903 True 262.400000 595 82.124667 412 3259 3 chr5A.!!$R2 2847

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
303 309 2.027007 TGCCCTAAAAGCTAGCCGTTTA 60.027 45.455 12.13 14.85 0.0 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3144 6591 3.393609 ACCTTCTTCCGGACTAACCTTTT 59.606 43.478 1.83 0.0 36.31 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 129 6.178239 ACTGTTGAATATGTCGCCTTTTAC 57.822 37.500 0.00 0.00 0.00 2.01
291 297 4.998051 AGAGGACAAAGAATGCCCTAAAA 58.002 39.130 0.00 0.00 42.78 1.52
303 309 2.027007 TGCCCTAAAAGCTAGCCGTTTA 60.027 45.455 12.13 14.85 0.00 2.01
1529 3641 3.930848 ACGGCTTTTCTTCGGTTACTATG 59.069 43.478 0.00 0.00 0.00 2.23
1839 5256 4.156922 TGGACGTTGTTTCAACATTTGTCT 59.843 37.500 12.08 0.00 38.95 3.41
3144 6591 9.268282 ACTAGTTTAGAGAGAATTTGGGTATGA 57.732 33.333 0.00 0.00 0.00 2.15
3751 7199 2.187958 CACCTGACCCACCTCATTCTA 58.812 52.381 0.00 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 129 7.712264 TGAAAATGCAGTTCATTGGTTAAAG 57.288 32.000 10.70 0.0 44.23 1.85
291 297 0.981943 AAGGGTGTAAACGGCTAGCT 59.018 50.000 15.72 0.0 0.00 3.32
303 309 2.969821 TCCATTGCAGTTAAGGGTGT 57.030 45.000 0.00 0.0 33.43 4.16
3144 6591 3.393609 ACCTTCTTCCGGACTAACCTTTT 59.606 43.478 1.83 0.0 36.31 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.