Multiple sequence alignment - TraesCS4B01G360100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G360100 chr4B 100.000 3160 0 0 772 3931 650409596 650406437 0.000000e+00 5836.0
1 TraesCS4B01G360100 chr4B 99.019 3159 28 2 773 3931 650529779 650526624 0.000000e+00 5659.0
2 TraesCS4B01G360100 chr4B 98.915 2674 27 1 1069 3740 650504348 650501675 0.000000e+00 4791.0
3 TraesCS4B01G360100 chr4B 99.562 1599 7 0 1538 3136 650489208 650487610 0.000000e+00 2915.0
4 TraesCS4B01G360100 chr4B 96.933 1663 49 2 1618 3280 650456939 650455279 0.000000e+00 2787.0
5 TraesCS4B01G360100 chr4B 100.000 711 0 0 1 711 650410367 650409657 0.000000e+00 1314.0
6 TraesCS4B01G360100 chr4B 96.164 782 28 2 772 1552 650457724 650456944 0.000000e+00 1277.0
7 TraesCS4B01G360100 chr4B 98.875 711 8 0 1 711 650505110 650504400 0.000000e+00 1269.0
8 TraesCS4B01G360100 chr4B 98.734 711 9 0 1 711 650491286 650490576 0.000000e+00 1264.0
9 TraesCS4B01G360100 chr4B 98.734 711 9 0 1 711 650530500 650529790 0.000000e+00 1264.0
10 TraesCS4B01G360100 chr4B 91.271 527 33 7 73 589 650458391 650457868 0.000000e+00 706.0
11 TraesCS4B01G360100 chr4B 98.319 119 2 0 3813 3931 650501548 650501430 3.980000e-50 209.0
12 TraesCS4B01G360100 chr4B 96.226 53 2 0 659 711 650457831 650457779 1.950000e-13 87.9
13 TraesCS4B01G360100 chr4B 90.909 55 5 0 3226 3280 650442465 650442411 1.510000e-09 75.0
14 TraesCS4B01G360100 chr4D 97.372 2511 55 2 772 3272 503999648 503997139 0.000000e+00 4261.0
15 TraesCS4B01G360100 chr4D 94.986 718 25 6 1 711 504000644 503999931 0.000000e+00 1116.0
16 TraesCS4B01G360100 chr4D 97.167 353 8 1 3286 3636 409498324 409498676 2.610000e-166 595.0
17 TraesCS4B01G360100 chrUn 82.418 2366 334 54 910 3224 110472031 110474365 0.000000e+00 1989.0
18 TraesCS4B01G360100 chrUn 98.485 1056 16 0 2621 3676 264767441 264766386 0.000000e+00 1862.0
19 TraesCS4B01G360100 chrUn 97.872 94 2 0 3838 3931 356364761 356364668 3.140000e-36 163.0
20 TraesCS4B01G360100 chrUn 98.734 79 1 0 1 79 303840449 303840527 1.470000e-29 141.0
21 TraesCS4B01G360100 chr5D 89.488 1113 117 0 1799 2911 5275057 5273945 0.000000e+00 1408.0
22 TraesCS4B01G360100 chr5D 84.099 893 117 16 774 1645 5275942 5275054 0.000000e+00 839.0
23 TraesCS4B01G360100 chr5B 89.068 1116 122 0 1796 2911 6624778 6625893 0.000000e+00 1386.0
24 TraesCS4B01G360100 chr5B 85.325 845 108 14 774 1607 6623897 6624736 0.000000e+00 859.0
25 TraesCS4B01G360100 chr5B 88.793 116 11 1 3110 3223 6475862 6475977 1.470000e-29 141.0
26 TraesCS4B01G360100 chr5B 89.583 48 3 2 665 711 31141264 31141310 4.240000e-05 60.2
27 TraesCS4B01G360100 chr5A 82.792 1569 226 29 1669 3224 700177081 700175544 0.000000e+00 1362.0
28 TraesCS4B01G360100 chr5A 85.142 848 110 13 774 1609 3505691 3506534 0.000000e+00 854.0
29 TraesCS4B01G360100 chr5A 84.262 610 90 1 890 1499 3618261 3617658 1.220000e-164 590.0
30 TraesCS4B01G360100 chr5A 83.444 151 22 2 3111 3259 3614996 3614847 1.910000e-28 137.0
31 TraesCS4B01G360100 chr5A 79.167 96 12 6 361 454 3620750 3620661 4.240000e-05 60.2
32 TraesCS4B01G360100 chr2B 97.436 351 9 0 3286 3636 170350370 170350020 2.020000e-167 599.0
33 TraesCS4B01G360100 chr2B 96.866 351 11 0 3286 3636 117978555 117978205 4.380000e-164 588.0
34 TraesCS4B01G360100 chr2B 92.308 52 1 3 3647 3698 139864940 139864892 1.960000e-08 71.3
35 TraesCS4B01G360100 chr1B 96.866 351 11 0 3286 3636 224177890 224178240 4.380000e-164 588.0
36 TraesCS4B01G360100 chr1B 96.601 353 11 1 3283 3634 19417367 19417719 5.660000e-163 584.0
37 TraesCS4B01G360100 chr1B 96.226 53 2 0 3647 3699 161298989 161299041 1.950000e-13 87.9
38 TraesCS4B01G360100 chr1B 95.556 45 2 0 3647 3691 502351723 502351767 5.450000e-09 73.1
39 TraesCS4B01G360100 chr1B 92.157 51 2 2 3647 3697 346291785 346291737 1.960000e-08 71.3
40 TraesCS4B01G360100 chr3B 96.056 355 12 2 3283 3636 9536178 9535825 9.470000e-161 577.0
41 TraesCS4B01G360100 chr3B 95.402 87 3 1 1 87 556054432 556054517 1.910000e-28 137.0
42 TraesCS4B01G360100 chr3B 95.402 87 3 1 1 87 810122423 810122338 1.910000e-28 137.0
43 TraesCS4B01G360100 chr3B 94.231 52 3 0 3647 3698 312360607 312360658 3.260000e-11 80.5
44 TraesCS4B01G360100 chr7A 98.750 80 1 0 1 80 261708424 261708345 4.090000e-30 143.0
45 TraesCS4B01G360100 chr7A 95.402 87 3 1 1 87 296380973 296381058 1.910000e-28 137.0
46 TraesCS4B01G360100 chr7A 89.362 47 4 1 3682 3728 684299477 684299522 1.530000e-04 58.4
47 TraesCS4B01G360100 chr7B 97.778 45 1 0 3647 3691 369157115 369157071 1.170000e-10 78.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G360100 chr4B 650406437 650410367 3930 True 3575.000000 5836 100.0000 1 3931 2 chr4B.!!$R2 3930
1 TraesCS4B01G360100 chr4B 650526624 650530500 3876 True 3461.500000 5659 98.8765 1 3931 2 chr4B.!!$R6 3930
2 TraesCS4B01G360100 chr4B 650501430 650505110 3680 True 2089.666667 4791 98.7030 1 3931 3 chr4B.!!$R5 3930
3 TraesCS4B01G360100 chr4B 650487610 650491286 3676 True 2089.500000 2915 99.1480 1 3136 2 chr4B.!!$R4 3135
4 TraesCS4B01G360100 chr4B 650455279 650458391 3112 True 1214.475000 2787 95.1485 73 3280 4 chr4B.!!$R3 3207
5 TraesCS4B01G360100 chr4D 503997139 504000644 3505 True 2688.500000 4261 96.1790 1 3272 2 chr4D.!!$R1 3271
6 TraesCS4B01G360100 chrUn 110472031 110474365 2334 False 1989.000000 1989 82.4180 910 3224 1 chrUn.!!$F1 2314
7 TraesCS4B01G360100 chrUn 264766386 264767441 1055 True 1862.000000 1862 98.4850 2621 3676 1 chrUn.!!$R1 1055
8 TraesCS4B01G360100 chr5D 5273945 5275942 1997 True 1123.500000 1408 86.7935 774 2911 2 chr5D.!!$R1 2137
9 TraesCS4B01G360100 chr5B 6623897 6625893 1996 False 1122.500000 1386 87.1965 774 2911 2 chr5B.!!$F3 2137
10 TraesCS4B01G360100 chr5A 700175544 700177081 1537 True 1362.000000 1362 82.7920 1669 3224 1 chr5A.!!$R1 1555
11 TraesCS4B01G360100 chr5A 3505691 3506534 843 False 854.000000 854 85.1420 774 1609 1 chr5A.!!$F1 835
12 TraesCS4B01G360100 chr5A 3614847 3620750 5903 True 262.400000 590 82.2910 361 3259 3 chr5A.!!$R2 2898

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
465 472 0.034756 ACAGCATGCCTTGTCGTACA 59.965 50.000 15.66 0.0 42.53 2.9 F
1067 3124 4.760530 TCTTCATAACTGCTGTAGCCAT 57.239 40.909 0.80 0.0 41.18 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2150 5522 0.744414 TAAGCCTGATGTGCGCCTTC 60.744 55.000 4.18 4.9 0.00 3.46 R
3060 6450 3.892588 ACTCCTAGTAGTGGCTAGATTGC 59.107 47.826 0.00 0.0 40.54 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 9.624697 GAACTGCATTTTCAATTGATGTAACTA 57.375 29.630 9.40 0.0 0.00 2.24
128 129 7.761038 TGATGTAACTATCGTATCTGGTCAT 57.239 36.000 0.00 0.0 0.00 3.06
292 298 5.812286 GGAAAGTTCCTACTAACCCATGAA 58.188 41.667 2.65 0.0 44.11 2.57
355 362 5.631119 ACCATTTGGGCAATACTATAGGAC 58.369 41.667 4.43 0.0 42.05 3.85
465 472 0.034756 ACAGCATGCCTTGTCGTACA 59.965 50.000 15.66 0.0 42.53 2.90
1067 3124 4.760530 TCTTCATAACTGCTGTAGCCAT 57.239 40.909 0.80 0.0 41.18 4.40
3752 7145 1.352352 CACCTGACCCACCTCATTCTT 59.648 52.381 0.00 0.0 0.00 2.52
3766 7159 2.814913 ATTCTTCCCGCAACCGACCC 62.815 60.000 0.00 0.0 36.29 4.46
3767 7160 4.323477 CTTCCCGCAACCGACCCA 62.323 66.667 0.00 0.0 36.29 4.51
3834 7281 1.277557 CCACTCTTCCACCTTCTCCTG 59.722 57.143 0.00 0.0 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 4.454678 ACATTTGCATGACCAGATACGAT 58.545 39.130 0.00 0.00 34.11 3.73
122 123 2.433604 ACCACAAACATTTGCATGACCA 59.566 40.909 0.00 0.00 41.79 4.02
128 129 2.433604 ACCATCACCACAAACATTTGCA 59.566 40.909 4.25 0.00 41.79 4.08
292 298 6.072508 CCATGCCAGTATTGCTTCGTTTATAT 60.073 38.462 0.00 0.00 0.00 0.86
780 2825 6.016276 ACAATGCGAGAATGAAAAAGTAACCT 60.016 34.615 0.00 0.00 0.00 3.50
1067 3124 6.653526 TGCTTTTCCATCTTGAAATCTTCA 57.346 33.333 0.00 0.00 34.41 3.02
1536 3597 9.337396 TGTATTGGAGAATATATGAAACCACAC 57.663 33.333 0.00 0.00 0.00 3.82
2150 5522 0.744414 TAAGCCTGATGTGCGCCTTC 60.744 55.000 4.18 4.90 0.00 3.46
3060 6450 3.892588 ACTCCTAGTAGTGGCTAGATTGC 59.107 47.826 0.00 0.00 40.54 3.56
3139 6531 4.778958 TCTTCGGGACTAACCTTTCCATAA 59.221 41.667 0.00 0.00 38.98 1.90
3380 6773 7.763356 TCGCTTTGGAGTATCTTAGATATAGC 58.237 38.462 5.15 7.11 33.73 2.97
3677 7070 5.013183 ACAGGGTGTTAGCAGAATAAGAGTT 59.987 40.000 0.00 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.