Multiple sequence alignment - TraesCS4B01G359600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G359600 chr4B 100.000 4039 0 0 1 4039 650040105 650036067 0.000000e+00 7459.0
1 TraesCS4B01G359600 chr4B 99.406 4041 21 2 1 4039 650111083 650107044 0.000000e+00 7326.0
2 TraesCS4B01G359600 chr4B 99.451 2184 11 1 863 3046 650171777 650169595 0.000000e+00 3965.0
3 TraesCS4B01G359600 chr4B 84.530 2172 254 52 1859 3993 649836310 649834184 0.000000e+00 2074.0
4 TraesCS4B01G359600 chr4B 96.484 711 25 0 985 1695 649837070 649836360 0.000000e+00 1175.0
5 TraesCS4B01G359600 chr4B 82.935 1172 197 3 1959 3129 665409595 665408426 0.000000e+00 1053.0
6 TraesCS4B01G359600 chr4B 98.039 561 10 1 1 560 649842067 649841507 0.000000e+00 974.0
7 TraesCS4B01G359600 chr4B 92.598 662 46 1 1015 1676 667572892 667572234 0.000000e+00 948.0
8 TraesCS4B01G359600 chr4B 99.371 477 3 0 1 477 650172743 650172267 0.000000e+00 865.0
9 TraesCS4B01G359600 chr4B 94.464 289 15 1 1 288 649839655 649839367 1.030000e-120 444.0
10 TraesCS4B01G359600 chr4B 89.381 339 19 8 556 884 649839254 649838923 1.040000e-110 411.0
11 TraesCS4B01G359600 chr4B 99.454 183 1 0 3857 4039 650168377 650168195 2.330000e-87 333.0
12 TraesCS4B01G359600 chr4B 95.489 133 4 2 303 433 649839384 649839252 1.140000e-50 211.0
13 TraesCS4B01G359600 chr4B 91.852 135 10 1 432 565 576982568 576982434 1.920000e-43 187.0
14 TraesCS4B01G359600 chr4B 88.333 60 0 3 892 945 649838930 649838872 9.370000e-07 65.8
15 TraesCS4B01G359600 chrUn 99.588 2184 8 1 863 3046 350362860 350360678 0.000000e+00 3982.0
16 TraesCS4B01G359600 chrUn 92.378 656 45 3 1022 1676 30086962 30087613 0.000000e+00 929.0
17 TraesCS4B01G359600 chrUn 81.934 1096 190 6 1959 3048 30088202 30089295 0.000000e+00 920.0
18 TraesCS4B01G359600 chrUn 88.776 686 68 5 993 1672 108497669 108498351 0.000000e+00 832.0
19 TraesCS4B01G359600 chrUn 99.235 392 3 0 3648 4039 475511417 475511026 0.000000e+00 708.0
20 TraesCS4B01G359600 chrUn 90.278 144 13 1 420 562 322720398 322720541 1.920000e-43 187.0
21 TraesCS4B01G359600 chr4D 87.724 1841 190 21 1762 3581 503920114 503918289 0.000000e+00 2115.0
22 TraesCS4B01G359600 chr4D 92.725 866 37 5 830 1695 503921123 503920284 0.000000e+00 1227.0
23 TraesCS4B01G359600 chr4D 94.067 691 38 2 987 1674 504043289 504043979 0.000000e+00 1046.0
24 TraesCS4B01G359600 chr4D 82.854 1079 177 7 1960 3034 504044738 504045812 0.000000e+00 961.0
25 TraesCS4B01G359600 chr4D 92.708 288 11 6 1 288 503921863 503921586 1.350000e-109 407.0
26 TraesCS4B01G359600 chr4D 89.573 211 10 3 647 845 503921349 503921139 1.440000e-64 257.0
27 TraesCS4B01G359600 chr4D 96.992 133 2 2 303 433 503921603 503921471 5.250000e-54 222.0
28 TraesCS4B01G359600 chr4D 93.846 130 8 0 431 560 505937196 505937325 3.180000e-46 196.0
29 TraesCS4B01G359600 chr4D 93.617 94 6 0 556 649 503921473 503921380 1.510000e-29 141.0
30 TraesCS4B01G359600 chr5A 87.452 1817 192 23 1757 3545 688613539 688611731 0.000000e+00 2060.0
31 TraesCS4B01G359600 chr5A 91.136 1162 56 11 556 1695 688614687 688613551 0.000000e+00 1531.0
32 TraesCS4B01G359600 chr5A 95.669 254 8 3 14 267 688615058 688614808 4.860000e-109 405.0
33 TraesCS4B01G359600 chr5A 92.481 133 10 0 432 564 652657840 652657708 1.480000e-44 191.0
34 TraesCS4B01G359600 chr5A 93.701 127 6 2 309 433 688614811 688614685 5.330000e-44 189.0
35 TraesCS4B01G359600 chr6D 90.951 652 54 4 1022 1672 433110589 433111236 0.000000e+00 872.0
36 TraesCS4B01G359600 chr7B 93.939 132 8 0 429 560 622350933 622350802 2.460000e-47 200.0
37 TraesCS4B01G359600 chr1D 92.537 134 9 1 426 558 178459645 178459512 1.480000e-44 191.0
38 TraesCS4B01G359600 chr1D 86.538 52 6 1 3811 3862 43138848 43138798 5.640000e-04 56.5
39 TraesCS4B01G359600 chr6B 91.852 135 11 0 424 558 172239765 172239631 5.330000e-44 189.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G359600 chr4B 650036067 650040105 4038 True 7459.000000 7459 100.000000 1 4039 1 chr4B.!!$R2 4038
1 TraesCS4B01G359600 chr4B 650107044 650111083 4039 True 7326.000000 7326 99.406000 1 4039 1 chr4B.!!$R3 4038
2 TraesCS4B01G359600 chr4B 650168195 650172743 4548 True 1721.000000 3965 99.425333 1 4039 3 chr4B.!!$R7 4038
3 TraesCS4B01G359600 chr4B 665408426 665409595 1169 True 1053.000000 1053 82.935000 1959 3129 1 chr4B.!!$R4 1170
4 TraesCS4B01G359600 chr4B 667572234 667572892 658 True 948.000000 948 92.598000 1015 1676 1 chr4B.!!$R5 661
5 TraesCS4B01G359600 chr4B 649834184 649842067 7883 True 764.971429 2074 92.388571 1 3993 7 chr4B.!!$R6 3992
6 TraesCS4B01G359600 chrUn 350360678 350362860 2182 True 3982.000000 3982 99.588000 863 3046 1 chrUn.!!$R1 2183
7 TraesCS4B01G359600 chrUn 30086962 30089295 2333 False 924.500000 929 87.156000 1022 3048 2 chrUn.!!$F3 2026
8 TraesCS4B01G359600 chrUn 108497669 108498351 682 False 832.000000 832 88.776000 993 1672 1 chrUn.!!$F1 679
9 TraesCS4B01G359600 chr4D 504043289 504045812 2523 False 1003.500000 1046 88.460500 987 3034 2 chr4D.!!$F2 2047
10 TraesCS4B01G359600 chr4D 503918289 503921863 3574 True 728.166667 2115 92.223167 1 3581 6 chr4D.!!$R1 3580
11 TraesCS4B01G359600 chr5A 688611731 688615058 3327 True 1046.250000 2060 91.989500 14 3545 4 chr5A.!!$R2 3531
12 TraesCS4B01G359600 chr6D 433110589 433111236 647 False 872.000000 872 90.951000 1022 1672 1 chr6D.!!$F1 650

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
299 301 5.904362 AGTCATATCTTTTCCAGCCAAAC 57.096 39.130 0.00 0.0 0.00 2.93 F
2272 7005 4.379243 CGCTCGGTGCAAGGAGGT 62.379 66.667 14.95 0.0 43.06 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2278 7011 4.447724 GCTTCTCAAACAACGATACAGACA 59.552 41.667 0.0 0.0 0.0 3.41 R
3257 8008 3.644966 ATTGACTTGGGAGCCGAATTA 57.355 42.857 0.0 0.0 0.0 1.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
299 301 5.904362 AGTCATATCTTTTCCAGCCAAAC 57.096 39.130 0.00 0.0 0.00 2.93
466 470 7.201487 CGTCCGAAAATACTTGTCATCACAATA 60.201 37.037 0.00 0.0 41.82 1.90
861 3204 8.036423 CAATCCATTGACTTTGCACAGATTGC 62.036 42.308 6.92 0.0 45.07 3.56
2272 7005 4.379243 CGCTCGGTGCAAGGAGGT 62.379 66.667 14.95 0.0 43.06 3.85
2278 7011 1.910580 CGGTGCAAGGAGGTACCCAT 61.911 60.000 8.74 0.0 40.05 4.00
2301 7034 4.447724 TGTCTGTATCGTTGTTTGAGAAGC 59.552 41.667 0.00 0.0 0.00 3.86
3257 8008 1.774254 TCTGGTGTCCCTCAACAATGT 59.226 47.619 0.00 0.0 43.67 2.71
3384 8137 6.472163 CGGCCAATCAACTTTTATGTGTAATC 59.528 38.462 2.24 0.0 0.00 1.75
3429 8184 9.002600 TGCATATCTAAGAAATATTCACGCATT 57.997 29.630 0.00 0.0 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2272 7005 4.811969 AACAACGATACAGACATGGGTA 57.188 40.909 0.00 0.0 0.00 3.69
2278 7011 4.447724 GCTTCTCAAACAACGATACAGACA 59.552 41.667 0.00 0.0 0.00 3.41
2787 7524 1.987855 CAGCCTCGGGGTACTTGGA 60.988 63.158 1.62 0.0 34.45 3.53
3257 8008 3.644966 ATTGACTTGGGAGCCGAATTA 57.355 42.857 0.00 0.0 0.00 1.40
3394 8147 4.706842 TCTTAGATATGCACCCCTTTCC 57.293 45.455 0.00 0.0 0.00 3.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.