Multiple sequence alignment - TraesCS4B01G359400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G359400 chr4B 100.000 2264 0 0 1 2264 649623168 649625431 0 4181
1 TraesCS4B01G359400 chr4B 99.117 2265 19 1 1 2264 655790979 655793243 0 4071
2 TraesCS4B01G359400 chr7B 99.293 2264 16 0 1 2264 102652613 102654876 0 4093
3 TraesCS4B01G359400 chr7B 99.072 2264 20 1 1 2264 133432652 133430390 0 4063
4 TraesCS4B01G359400 chr4A 99.249 2264 16 1 1 2264 735292696 735294958 0 4085
5 TraesCS4B01G359400 chr5B 99.117 2264 19 1 1 2264 281832852 281830590 0 4069
6 TraesCS4B01G359400 chr5B 98.940 2264 24 0 1 2264 351469615 351467352 0 4048
7 TraesCS4B01G359400 chr1B 98.852 2264 26 0 1 2264 302772357 302770094 0 4037
8 TraesCS4B01G359400 chr7A 98.499 2265 31 3 1 2264 16005012 16007274 0 3991
9 TraesCS4B01G359400 chr2A 98.498 2264 33 1 1 2264 728933673 728935935 0 3991


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G359400 chr4B 649623168 649625431 2263 False 4181 4181 100.000 1 2264 1 chr4B.!!$F1 2263
1 TraesCS4B01G359400 chr4B 655790979 655793243 2264 False 4071 4071 99.117 1 2264 1 chr4B.!!$F2 2263
2 TraesCS4B01G359400 chr7B 102652613 102654876 2263 False 4093 4093 99.293 1 2264 1 chr7B.!!$F1 2263
3 TraesCS4B01G359400 chr7B 133430390 133432652 2262 True 4063 4063 99.072 1 2264 1 chr7B.!!$R1 2263
4 TraesCS4B01G359400 chr4A 735292696 735294958 2262 False 4085 4085 99.249 1 2264 1 chr4A.!!$F1 2263
5 TraesCS4B01G359400 chr5B 281830590 281832852 2262 True 4069 4069 99.117 1 2264 1 chr5B.!!$R1 2263
6 TraesCS4B01G359400 chr5B 351467352 351469615 2263 True 4048 4048 98.940 1 2264 1 chr5B.!!$R2 2263
7 TraesCS4B01G359400 chr1B 302770094 302772357 2263 True 4037 4037 98.852 1 2264 1 chr1B.!!$R1 2263
8 TraesCS4B01G359400 chr7A 16005012 16007274 2262 False 3991 3991 98.499 1 2264 1 chr7A.!!$F1 2263
9 TraesCS4B01G359400 chr2A 728933673 728935935 2262 False 3991 3991 98.498 1 2264 1 chr2A.!!$F1 2263

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
162 163 4.753516 TTGAGGTGAAACTGAAGACTCA 57.246 40.909 0.00 0.0 36.74 3.41 F
1016 1019 1.322538 GGCATGGCTTCATCCGGTTT 61.323 55.000 12.86 0.0 0.00 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1016 1019 4.988716 ACGGTGGCCTCGTCCTGA 62.989 66.667 16.76 0.0 35.87 3.86 R
2225 2228 2.357517 GTCTGGTCACCTGCGTGG 60.358 66.667 0.00 0.0 40.65 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 4.753516 TTGAGGTGAAACTGAAGACTCA 57.246 40.909 0.00 0.0 36.74 3.41
1016 1019 1.322538 GGCATGGCTTCATCCGGTTT 61.323 55.000 12.86 0.0 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 3.231889 CTCTCGCACTGGCACCACT 62.232 63.158 0.00 0.0 41.24 4.00
538 540 1.226491 GCATGTCCGCTCATTGTGC 60.226 57.895 0.60 0.6 0.00 4.57
1016 1019 4.988716 ACGGTGGCCTCGTCCTGA 62.989 66.667 16.76 0.0 35.87 3.86
2225 2228 2.357517 GTCTGGTCACCTGCGTGG 60.358 66.667 0.00 0.0 40.65 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.