Multiple sequence alignment - TraesCS4B01G357600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G357600 chr4B 100.000 3608 0 0 1 3608 648192894 648196501 0.000000e+00 6663.0
1 TraesCS4B01G357600 chr4B 99.334 3604 23 1 1 3604 648268193 648271795 0.000000e+00 6521.0
2 TraesCS4B01G357600 chr4B 98.557 3604 20 2 1 3604 648218320 648221891 0.000000e+00 6338.0
3 TraesCS4B01G357600 chr4B 99.237 3144 23 1 465 3608 648242627 648245769 0.000000e+00 5672.0
4 TraesCS4B01G357600 chr4B 91.302 1759 81 28 958 2654 647694013 647692265 0.000000e+00 2335.0
5 TraesCS4B01G357600 chr4B 92.199 423 14 3 1 408 647698648 647698230 6.720000e-162 580.0
6 TraesCS4B01G357600 chr4B 94.907 216 9 2 3323 3536 648313165 648313380 1.600000e-88 337.0
7 TraesCS4B01G357600 chr4B 100.000 133 0 0 1 133 648241818 648241950 2.780000e-61 246.0
8 TraesCS4B01G357600 chr4B 91.566 83 6 1 721 803 647694359 647694278 2.940000e-21 113.0
9 TraesCS4B01G357600 chr4B 89.157 83 6 3 884 965 647694116 647694036 2.290000e-17 100.0
10 TraesCS4B01G357600 chr4B 96.296 54 2 0 663 716 647694628 647694575 4.960000e-14 89.8
11 TraesCS4B01G357600 chr4D 90.816 1764 82 26 958 2654 503175754 503177504 0.000000e+00 2287.0
12 TraesCS4B01G357600 chr4D 96.088 409 6 4 1 408 503174553 503174952 0.000000e+00 658.0
13 TraesCS4B01G357600 chr4D 88.158 304 26 7 2993 3293 503177600 503177896 1.590000e-93 353.0
14 TraesCS4B01G357600 chr4D 94.595 222 9 3 3323 3541 503254018 503254239 1.240000e-89 340.0
15 TraesCS4B01G357600 chr4D 95.495 111 5 0 441 551 503175113 503175223 1.030000e-40 178.0
16 TraesCS4B01G357600 chr4D 89.147 129 6 5 547 667 238379218 238379346 1.730000e-33 154.0
17 TraesCS4B01G357600 chr4D 89.147 129 6 5 547 667 344231839 344231967 1.730000e-33 154.0
18 TraesCS4B01G357600 chr4D 80.982 163 8 6 819 959 503175565 503175726 1.370000e-19 108.0
19 TraesCS4B01G357600 chr4D 98.214 56 1 0 663 718 503175219 503175274 8.240000e-17 99.0
20 TraesCS4B01G357600 chr5A 89.324 1761 93 36 958 2628 687654978 687656733 0.000000e+00 2122.0
21 TraesCS4B01G357600 chr5A 91.722 302 20 2 2993 3293 687656838 687657135 7.210000e-112 414.0
22 TraesCS4B01G357600 chr5A 87.063 286 16 8 140 408 687653800 687654081 1.630000e-78 303.0
23 TraesCS4B01G357600 chr5A 90.909 66 3 3 822 886 687654792 687654855 6.420000e-13 86.1
24 TraesCS4B01G357600 chr5A 95.349 43 2 0 760 802 687654759 687654801 6.460000e-08 69.4
25 TraesCS4B01G357600 chr6B 83.629 1240 161 30 1125 2344 14126319 14127536 0.000000e+00 1127.0
26 TraesCS4B01G357600 chr6B 85.444 1003 137 8 1347 2346 13975261 13974265 0.000000e+00 1035.0
27 TraesCS4B01G357600 chr6B 99.178 365 2 1 2634 2997 410235852 410235488 0.000000e+00 656.0
28 TraesCS4B01G357600 chr6A 83.535 1239 165 32 1125 2344 7697569 7698787 0.000000e+00 1122.0
29 TraesCS4B01G357600 chr6A 86.070 1005 130 8 1347 2346 7398206 7397207 0.000000e+00 1072.0
30 TraesCS4B01G357600 chr6A 84.270 89 11 3 3056 3143 186990784 186990698 2.310000e-12 84.2
31 TraesCS4B01G357600 chr6A 89.583 48 2 3 218 265 9250307 9250351 1.400000e-04 58.4
32 TraesCS4B01G357600 chr6D 85.925 1016 129 11 1336 2344 7552302 7553310 0.000000e+00 1072.0
33 TraesCS4B01G357600 chr6D 89.147 129 6 5 547 667 312264206 312264078 1.730000e-33 154.0
34 TraesCS4B01G357600 chr3A 99.455 367 2 0 2625 2991 319968820 319968454 0.000000e+00 667.0
35 TraesCS4B01G357600 chr3A 99.183 367 2 1 2630 2996 698274613 698274978 0.000000e+00 660.0
36 TraesCS4B01G357600 chr3A 83.562 73 8 4 3217 3289 13244948 13245016 8.360000e-07 65.8
37 TraesCS4B01G357600 chr3A 100.000 28 0 0 231 258 598941461 598941488 7.000000e-03 52.8
38 TraesCS4B01G357600 chrUn 98.910 367 4 0 2625 2991 119851703 119851337 0.000000e+00 656.0
39 TraesCS4B01G357600 chrUn 92.754 69 4 1 3443 3511 108278108 108278041 8.240000e-17 99.0
40 TraesCS4B01G357600 chr7B 97.884 378 6 2 2615 2991 26880283 26880659 0.000000e+00 652.0
41 TraesCS4B01G357600 chr7B 87.273 55 6 1 3089 3142 658031523 658031577 1.080000e-05 62.1
42 TraesCS4B01G357600 chr5B 98.133 375 4 3 2623 2994 692693054 692693428 0.000000e+00 651.0
43 TraesCS4B01G357600 chr5B 76.978 139 25 5 3008 3143 670139237 670139371 5.000000e-09 73.1
44 TraesCS4B01G357600 chr5B 84.932 73 7 4 3217 3289 478323703 478323771 1.800000e-08 71.3
45 TraesCS4B01G357600 chr3B 90.714 140 13 0 1 140 254193047 254193186 1.710000e-43 187.0
46 TraesCS4B01G357600 chr3B 90.141 142 14 0 1 142 755478623 755478482 6.150000e-43 185.0
47 TraesCS4B01G357600 chr3B 89.189 148 12 4 1 146 104273974 104273829 7.960000e-42 182.0
48 TraesCS4B01G357600 chr2A 89.286 140 13 2 6 144 4218382 4218244 1.330000e-39 174.0
49 TraesCS4B01G357600 chr7D 89.922 129 5 6 547 667 60525415 60525543 3.730000e-35 159.0
50 TraesCS4B01G357600 chr2B 88.406 138 6 7 539 667 378986168 378986032 1.340000e-34 158.0
51 TraesCS4B01G357600 chr1A 87.500 136 11 4 547 678 365069486 365069619 6.240000e-33 152.0
52 TraesCS4B01G357600 chr1A 91.489 47 4 0 219 265 3385866 3385912 8.360000e-07 65.8
53 TraesCS4B01G357600 chr1B 83.562 73 8 2 3217 3289 582937944 582937876 8.360000e-07 65.8
54 TraesCS4B01G357600 chr7A 83.333 72 8 1 3218 3289 711784073 711784140 3.010000e-06 63.9
55 TraesCS4B01G357600 chr4A 100.000 28 0 0 3093 3120 587204215 587204188 7.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G357600 chr4B 648192894 648196501 3607 False 6663.000000 6663 100.0000 1 3608 1 chr4B.!!$F1 3607
1 TraesCS4B01G357600 chr4B 648268193 648271795 3602 False 6521.000000 6521 99.3340 1 3604 1 chr4B.!!$F3 3603
2 TraesCS4B01G357600 chr4B 648218320 648221891 3571 False 6338.000000 6338 98.5570 1 3604 1 chr4B.!!$F2 3603
3 TraesCS4B01G357600 chr4B 648241818 648245769 3951 False 2959.000000 5672 99.6185 1 3608 2 chr4B.!!$F5 3607
4 TraesCS4B01G357600 chr4B 647692265 647698648 6383 True 643.560000 2335 92.1040 1 2654 5 chr4B.!!$R1 2653
5 TraesCS4B01G357600 chr4D 503174553 503177896 3343 False 613.833333 2287 91.6255 1 3293 6 chr4D.!!$F4 3292
6 TraesCS4B01G357600 chr5A 687653800 687657135 3335 False 598.900000 2122 90.8734 140 3293 5 chr5A.!!$F1 3153
7 TraesCS4B01G357600 chr6B 14126319 14127536 1217 False 1127.000000 1127 83.6290 1125 2344 1 chr6B.!!$F1 1219
8 TraesCS4B01G357600 chr6B 13974265 13975261 996 True 1035.000000 1035 85.4440 1347 2346 1 chr6B.!!$R1 999
9 TraesCS4B01G357600 chr6A 7697569 7698787 1218 False 1122.000000 1122 83.5350 1125 2344 1 chr6A.!!$F1 1219
10 TraesCS4B01G357600 chr6A 7397207 7398206 999 True 1072.000000 1072 86.0700 1347 2346 1 chr6A.!!$R1 999
11 TraesCS4B01G357600 chr6D 7552302 7553310 1008 False 1072.000000 1072 85.9250 1336 2344 1 chr6D.!!$F1 1008

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
904 4878 2.664835 AAACATTCCCCGCCCAACCA 62.665 55.0 0.0 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3405 7577 5.197451 GAGATCACGATATCCTCACCCTAT 58.803 45.833 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
904 4878 2.664835 AAACATTCCCCGCCCAACCA 62.665 55.000 0.00 0.0 0.0 3.67
1185 5245 2.342648 GCCGACAACCTCTTCCGT 59.657 61.111 0.00 0.0 0.0 4.69
3487 7659 5.707298 AGGTGTGTAGTTAACTCTAGCGTAA 59.293 40.000 12.39 0.0 0.0 3.18
3561 7733 2.882927 AAACTACTCGTGTGCTGTCA 57.117 45.000 0.00 0.0 0.0 3.58
3562 7734 2.423926 AACTACTCGTGTGCTGTCAG 57.576 50.000 0.00 0.0 0.0 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
463 625 7.904558 ACAAGTGAACCAGATATAGAGATGA 57.095 36.000 0.00 0.00 0.00 2.92
3405 7577 5.197451 GAGATCACGATATCCTCACCCTAT 58.803 45.833 0.00 0.00 0.00 2.57
3495 7667 2.029828 ACACGCTTGAGAACTCGAGATT 60.030 45.455 21.68 9.73 42.44 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.