Multiple sequence alignment - TraesCS4B01G348400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G348400 chr4B 100.000 3875 0 0 1 3875 641684843 641688717 0.000000e+00 7156.0
1 TraesCS4B01G348400 chr4B 99.458 3877 18 3 1 3875 641608737 641612612 0.000000e+00 7040.0
2 TraesCS4B01G348400 chr4B 99.252 3878 19 4 1 3875 641567556 641571426 0.000000e+00 6992.0
3 TraesCS4B01G348400 chr4B 98.924 3903 14 2 1 3875 641645441 641649343 0.000000e+00 6950.0
4 TraesCS4B01G348400 chr4B 98.305 3894 20 13 1 3875 641776510 641780376 0.000000e+00 6783.0
5 TraesCS4B01G348400 chr4B 92.696 2971 133 46 728 3678 641482147 641485053 0.000000e+00 4207.0
6 TraesCS4B01G348400 chr4B 93.175 2491 115 30 933 3378 641541901 641544381 0.000000e+00 3607.0
7 TraesCS4B01G348400 chr4B 92.808 2489 135 23 933 3381 641521619 641524103 0.000000e+00 3565.0
8 TraesCS4B01G348400 chr4B 97.667 900 2 2 2995 3875 641740054 641740953 0.000000e+00 1528.0
9 TraesCS4B01G348400 chr4B 99.502 201 1 0 3675 3875 641578833 641579033 2.200000e-97 366.0
10 TraesCS4B01G348400 chr4B 99.502 201 1 0 3675 3875 641656176 641656376 2.200000e-97 366.0
11 TraesCS4B01G348400 chr4B 99.502 201 1 0 3675 3875 641695409 641695609 2.200000e-97 366.0
12 TraesCS4B01G348400 chr4B 82.323 396 43 14 465 851 641540605 641540982 6.250000e-83 318.0
13 TraesCS4B01G348400 chr4B 86.458 288 21 6 582 852 641541576 641541862 2.260000e-77 300.0
14 TraesCS4B01G348400 chr4B 88.961 154 14 3 492 645 641481931 641482081 1.840000e-43 187.0
15 TraesCS4B01G348400 chr4B 94.286 35 2 0 3440 3474 641484775 641484809 2.000000e-03 54.7
16 TraesCS4B01G348400 chr5A 89.429 3046 227 59 426 3441 679777716 679780696 0.000000e+00 3753.0
17 TraesCS4B01G348400 chr5A 96.970 33 1 0 3440 3472 679780628 679780660 5.410000e-04 56.5
18 TraesCS4B01G348400 chrUn 99.626 1337 5 0 1022 2358 410175031 410173695 0.000000e+00 2442.0
19 TraesCS4B01G348400 chrUn 99.766 854 2 0 1 854 421756176 421757029 0.000000e+00 1567.0
20 TraesCS4B01G348400 chr4D 88.084 663 43 23 933 1570 499167465 499168116 0.000000e+00 754.0
21 TraesCS4B01G348400 chr4D 84.112 428 57 6 3 420 467584941 467584515 1.680000e-108 403.0
22 TraesCS4B01G348400 chr4D 82.240 366 42 14 492 852 499106943 499107290 1.050000e-75 294.0
23 TraesCS4B01G348400 chr4D 92.754 138 8 2 716 852 499120526 499120662 8.490000e-47 198.0
24 TraesCS4B01G348400 chr4D 92.754 138 8 2 716 852 499167290 499167426 8.490000e-47 198.0
25 TraesCS4B01G348400 chr4D 90.076 131 10 2 426 553 499120276 499120406 2.390000e-37 167.0
26 TraesCS4B01G348400 chr4D 90.076 131 10 2 426 553 499167040 499167170 2.390000e-37 167.0
27 TraesCS4B01G348400 chr4D 84.242 165 18 3 3515 3678 499217769 499217926 1.860000e-33 154.0
28 TraesCS4B01G348400 chr7D 86.824 425 42 8 3 416 535790856 535790435 2.730000e-126 462.0
29 TraesCS4B01G348400 chr5D 86.730 422 46 7 3 415 55048331 55048751 9.810000e-126 460.0
30 TraesCS4B01G348400 chr5D 84.397 423 56 5 3 416 456815686 456815265 1.300000e-109 407.0
31 TraesCS4B01G348400 chr6B 97.619 210 5 0 3666 3875 18921874 18922083 1.020000e-95 361.0
32 TraesCS4B01G348400 chr6B 90.196 51 2 3 3630 3679 657283178 657283130 3.230000e-06 63.9
33 TraesCS4B01G348400 chr3B 96.347 219 6 2 3658 3875 105031596 105031379 3.680000e-95 359.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G348400 chr4B 641684843 641688717 3874 False 7156.000000 7156 100.000000 1 3875 1 chr4B.!!$F7 3874
1 TraesCS4B01G348400 chr4B 641608737 641612612 3875 False 7040.000000 7040 99.458000 1 3875 1 chr4B.!!$F4 3874
2 TraesCS4B01G348400 chr4B 641567556 641571426 3870 False 6992.000000 6992 99.252000 1 3875 1 chr4B.!!$F2 3874
3 TraesCS4B01G348400 chr4B 641645441 641649343 3902 False 6950.000000 6950 98.924000 1 3875 1 chr4B.!!$F5 3874
4 TraesCS4B01G348400 chr4B 641776510 641780376 3866 False 6783.000000 6783 98.305000 1 3875 1 chr4B.!!$F10 3874
5 TraesCS4B01G348400 chr4B 641521619 641524103 2484 False 3565.000000 3565 92.808000 933 3381 1 chr4B.!!$F1 2448
6 TraesCS4B01G348400 chr4B 641740054 641740953 899 False 1528.000000 1528 97.667000 2995 3875 1 chr4B.!!$F9 880
7 TraesCS4B01G348400 chr4B 641481931 641485053 3122 False 1482.900000 4207 91.981000 492 3678 3 chr4B.!!$F11 3186
8 TraesCS4B01G348400 chr4B 641540605 641544381 3776 False 1408.333333 3607 87.318667 465 3378 3 chr4B.!!$F12 2913
9 TraesCS4B01G348400 chr5A 679777716 679780696 2980 False 1904.750000 3753 93.199500 426 3472 2 chr5A.!!$F1 3046
10 TraesCS4B01G348400 chrUn 410173695 410175031 1336 True 2442.000000 2442 99.626000 1022 2358 1 chrUn.!!$R1 1336
11 TraesCS4B01G348400 chrUn 421756176 421757029 853 False 1567.000000 1567 99.766000 1 854 1 chrUn.!!$F1 853
12 TraesCS4B01G348400 chr4D 499167040 499168116 1076 False 373.000000 754 90.304667 426 1570 3 chr4D.!!$F4 1144

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2358 3386 2.919971 GCGTGGAGTTCAAGCTCTT 58.08 52.632 1.57 0.0 45.31 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3593 4709 1.526575 GCCAACAGCAGCTAAAGCCA 61.527 55.0 0.0 0.0 43.38 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2358 3386 2.919971 GCGTGGAGTTCAAGCTCTT 58.080 52.632 1.57 0.0 45.31 2.85
3593 4709 5.227569 TGTAATCACCAGAACATGTGACT 57.772 39.130 0.00 0.0 43.69 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
218 219 1.890041 CGAAGACAACACCCGGCAA 60.890 57.895 0.0 0.0 0.00 4.52
2358 3386 2.158856 TCACCGTAGATCCTAGCTTCGA 60.159 50.000 0.0 0.0 0.00 3.71
3593 4709 1.526575 GCCAACAGCAGCTAAAGCCA 61.527 55.000 0.0 0.0 43.38 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.