Multiple sequence alignment - TraesCS4B01G348300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G348300 chr4B 100.000 3876 0 0 1 3876 641608737 641612612 0.000000e+00 7158.0
1 TraesCS4B01G348300 chr4B 99.458 3877 18 3 1 3876 641684843 641688717 0.000000e+00 7040.0
2 TraesCS4B01G348300 chr4B 99.149 3880 20 6 1 3876 641567556 641571426 0.000000e+00 6970.0
3 TraesCS4B01G348300 chr4B 98.822 3904 17 4 1 3876 641645441 641649343 0.000000e+00 6927.0
4 TraesCS4B01G348300 chr4B 98.100 3895 27 15 1 3876 641776510 641780376 0.000000e+00 6739.0
5 TraesCS4B01G348300 chr4B 92.564 2972 136 47 728 3679 641482147 641485053 0.000000e+00 4185.0
6 TraesCS4B01G348300 chr4B 92.937 2492 120 31 933 3379 641541901 641544381 0.000000e+00 3576.0
7 TraesCS4B01G348300 chr4B 92.570 2490 140 24 933 3382 641521619 641524103 0.000000e+00 3531.0
8 TraesCS4B01G348300 chr4B 97.111 900 7 3 2996 3876 641740054 641740953 0.000000e+00 1500.0
9 TraesCS4B01G348300 chr4B 99.502 201 1 0 3676 3876 641578833 641579033 2.200000e-97 366.0
10 TraesCS4B01G348300 chr4B 99.502 201 1 0 3676 3876 641656176 641656376 2.200000e-97 366.0
11 TraesCS4B01G348300 chr4B 99.502 201 1 0 3676 3876 641695409 641695609 2.200000e-97 366.0
12 TraesCS4B01G348300 chr4B 82.323 396 43 14 465 851 641540605 641540982 6.250000e-83 318.0
13 TraesCS4B01G348300 chr4B 86.458 288 21 6 582 852 641541576 641541862 2.260000e-77 300.0
14 TraesCS4B01G348300 chr4B 88.961 154 14 3 492 645 641481931 641482081 1.840000e-43 187.0
15 TraesCS4B01G348300 chr4B 84.906 106 14 2 3269 3372 641422992 641423097 5.300000e-19 106.0
16 TraesCS4B01G348300 chr4B 90.244 41 4 0 3434 3474 641484769 641484809 2.000000e-03 54.7
17 TraesCS4B01G348300 chr5A 89.341 3049 224 64 426 3441 679777716 679780696 0.000000e+00 3736.0
18 TraesCS4B01G348300 chr5A 96.970 33 1 0 3440 3472 679780628 679780660 5.410000e-04 56.5
19 TraesCS4B01G348300 chrUn 99.253 1338 9 1 1022 2359 410175031 410173695 0.000000e+00 2414.0
20 TraesCS4B01G348300 chrUn 100.000 854 0 0 1 854 421756176 421757029 0.000000e+00 1578.0
21 TraesCS4B01G348300 chr4D 87.783 663 45 23 933 1570 499167465 499168116 0.000000e+00 743.0
22 TraesCS4B01G348300 chr4D 84.112 428 57 6 3 420 467584941 467584515 1.680000e-108 403.0
23 TraesCS4B01G348300 chr4D 82.240 366 42 14 492 852 499106943 499107290 1.050000e-75 294.0
24 TraesCS4B01G348300 chr4D 92.754 138 8 2 716 852 499120526 499120662 8.490000e-47 198.0
25 TraesCS4B01G348300 chr4D 92.754 138 8 2 716 852 499167290 499167426 8.490000e-47 198.0
26 TraesCS4B01G348300 chr4D 90.076 131 10 2 426 553 499120276 499120406 2.400000e-37 167.0
27 TraesCS4B01G348300 chr4D 90.076 131 10 2 426 553 499167040 499167170 2.400000e-37 167.0
28 TraesCS4B01G348300 chr4D 85.119 168 13 4 3512 3679 499217771 499217926 1.110000e-35 161.0
29 TraesCS4B01G348300 chr7D 86.824 425 42 8 3 416 535790856 535790435 2.730000e-126 462.0
30 TraesCS4B01G348300 chr5D 86.730 422 46 7 3 415 55048331 55048751 9.810000e-126 460.0
31 TraesCS4B01G348300 chr5D 84.397 423 56 5 3 416 456815686 456815265 1.300000e-109 407.0
32 TraesCS4B01G348300 chr6B 97.619 210 5 0 3667 3876 18921874 18922083 1.020000e-95 361.0
33 TraesCS4B01G348300 chr6B 90.196 51 2 3 3631 3680 657283178 657283130 3.230000e-06 63.9
34 TraesCS4B01G348300 chr3B 96.347 219 6 2 3659 3876 105031596 105031379 3.680000e-95 359.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G348300 chr4B 641608737 641612612 3875 False 7158.000000 7158 100.000000 1 3876 1 chr4B.!!$F5 3875
1 TraesCS4B01G348300 chr4B 641684843 641688717 3874 False 7040.000000 7040 99.458000 1 3876 1 chr4B.!!$F8 3875
2 TraesCS4B01G348300 chr4B 641567556 641571426 3870 False 6970.000000 6970 99.149000 1 3876 1 chr4B.!!$F3 3875
3 TraesCS4B01G348300 chr4B 641645441 641649343 3902 False 6927.000000 6927 98.822000 1 3876 1 chr4B.!!$F6 3875
4 TraesCS4B01G348300 chr4B 641776510 641780376 3866 False 6739.000000 6739 98.100000 1 3876 1 chr4B.!!$F11 3875
5 TraesCS4B01G348300 chr4B 641521619 641524103 2484 False 3531.000000 3531 92.570000 933 3382 1 chr4B.!!$F2 2449
6 TraesCS4B01G348300 chr4B 641740054 641740953 899 False 1500.000000 1500 97.111000 2996 3876 1 chr4B.!!$F10 880
7 TraesCS4B01G348300 chr4B 641481931 641485053 3122 False 1475.566667 4185 90.589667 492 3679 3 chr4B.!!$F12 3187
8 TraesCS4B01G348300 chr4B 641540605 641544381 3776 False 1398.000000 3576 87.239333 465 3379 3 chr4B.!!$F13 2914
9 TraesCS4B01G348300 chr5A 679777716 679780696 2980 False 1896.250000 3736 93.155500 426 3472 2 chr5A.!!$F1 3046
10 TraesCS4B01G348300 chrUn 410173695 410175031 1336 True 2414.000000 2414 99.253000 1022 2359 1 chrUn.!!$R1 1337
11 TraesCS4B01G348300 chrUn 421756176 421757029 853 False 1578.000000 1578 100.000000 1 854 1 chrUn.!!$F1 853
12 TraesCS4B01G348300 chr4D 499167040 499168116 1076 False 369.333333 743 90.204333 426 1570 3 chr4D.!!$F4 1144

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
973 1898 4.494484 CAGCACCGCAGCAGTATATATAA 58.506 43.478 0.0 0.0 36.85 0.98 F
1678 2693 7.902087 TGTCTTGGAGGAAAAAGAAAAAGAAA 58.098 30.769 0.0 0.0 34.33 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2728 3755 1.905215 CTCCTGTGGTCAGAATGTCCT 59.095 52.381 0.0 0.0 44.96 3.85 R
3523 4621 3.316283 ACAGCAACAACAACAACAACAG 58.684 40.909 0.0 0.0 0.00 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
973 1898 4.494484 CAGCACCGCAGCAGTATATATAA 58.506 43.478 0.0 0.0 36.85 0.98
1678 2693 7.902087 TGTCTTGGAGGAAAAAGAAAAAGAAA 58.098 30.769 0.0 0.0 34.33 2.52
2728 3755 2.168496 CCCGTTCTCCTACACTCAGAA 58.832 52.381 0.0 0.0 0.00 3.02
2885 3912 6.838612 AGCAGTATTAAATAAAGCCATCCCAA 59.161 34.615 0.0 0.0 0.00 4.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1678 2693 4.142600 GCAGCTATCGGTGTTGATCTTTTT 60.143 41.667 0.00 0.00 40.67 1.94
2728 3755 1.905215 CTCCTGTGGTCAGAATGTCCT 59.095 52.381 0.00 0.00 44.96 3.85
3083 4146 3.543680 AACCGTATCAACAGCTGCTAT 57.456 42.857 15.27 7.45 0.00 2.97
3513 4581 4.314121 ACAACAACAACAGCAACAACAAT 58.686 34.783 0.00 0.00 0.00 2.71
3523 4621 3.316283 ACAGCAACAACAACAACAACAG 58.684 40.909 0.00 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.