Multiple sequence alignment - TraesCS4B01G348200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G348200 chr4B 100.000 3873 0 0 1 3873 641567556 641571428 0.000000e+00 7153.0
1 TraesCS4B01G348200 chr4B 99.253 3880 19 4 1 3873 641684843 641688719 0.000000e+00 6996.0
2 TraesCS4B01G348200 chr4B 99.150 3882 20 6 1 3873 641608737 641612614 0.000000e+00 6974.0
3 TraesCS4B01G348200 chr4B 98.024 3896 27 14 1 3873 641776510 641780378 0.000000e+00 6722.0
4 TraesCS4B01G348200 chr4B 99.328 3571 22 1 1 3569 641645441 641649011 0.000000e+00 6460.0
5 TraesCS4B01G348200 chr4B 92.621 2968 137 44 728 3674 641482147 641485053 0.000000e+00 4193.0
6 TraesCS4B01G348200 chr4B 90.550 2857 157 62 582 3376 641541576 641544381 0.000000e+00 3675.0
7 TraesCS4B01G348200 chr4B 92.688 2489 136 25 933 3379 641521619 641524103 0.000000e+00 3546.0
8 TraesCS4B01G348200 chr4B 96.785 902 8 2 2993 3873 641740054 641740955 0.000000e+00 1485.0
9 TraesCS4B01G348200 chr4B 98.365 367 6 0 3507 3873 641648979 641649345 0.000000e+00 645.0
10 TraesCS4B01G348200 chr4B 99.015 203 2 0 3671 3873 641578833 641579035 7.910000e-97 364.0
11 TraesCS4B01G348200 chr4B 99.015 203 2 0 3671 3873 641656176 641656378 7.910000e-97 364.0
12 TraesCS4B01G348200 chr4B 99.015 203 2 0 3671 3873 641695409 641695611 7.910000e-97 364.0
13 TraesCS4B01G348200 chr4B 82.323 396 43 14 465 851 641540605 641540982 6.240000e-83 318.0
14 TraesCS4B01G348200 chr4B 88.961 154 14 3 492 645 641481931 641482081 1.840000e-43 187.0
15 TraesCS4B01G348200 chr4B 84.906 106 14 2 3266 3369 641422992 641423097 5.290000e-19 106.0
16 TraesCS4B01G348200 chr4B 94.286 35 2 0 3438 3472 641484775 641484809 2.000000e-03 54.7
17 TraesCS4B01G348200 chr5A 89.239 3048 227 65 426 3439 679777716 679780696 0.000000e+00 3718.0
18 TraesCS4B01G348200 chr5A 96.970 33 1 0 3438 3470 679780628 679780660 5.410000e-04 56.5
19 TraesCS4B01G348200 chrUn 99.551 1337 6 0 1020 2356 410175031 410173695 0.000000e+00 2436.0
20 TraesCS4B01G348200 chrUn 99.649 854 3 0 1 854 421756176 421757029 0.000000e+00 1561.0
21 TraesCS4B01G348200 chr4D 88.200 661 44 23 933 1568 499167465 499168116 0.000000e+00 758.0
22 TraesCS4B01G348200 chr4D 83.916 429 56 8 3 420 467584941 467584515 7.800000e-107 398.0
23 TraesCS4B01G348200 chr4D 82.240 366 42 14 492 852 499106943 499107290 1.050000e-75 294.0
24 TraesCS4B01G348200 chr4D 92.754 138 8 2 716 852 499120526 499120662 8.490000e-47 198.0
25 TraesCS4B01G348200 chr4D 92.754 138 8 2 716 852 499167290 499167426 8.490000e-47 198.0
26 TraesCS4B01G348200 chr4D 90.076 131 10 2 426 553 499120276 499120406 2.390000e-37 167.0
27 TraesCS4B01G348200 chr4D 90.076 131 10 2 426 553 499167040 499167170 2.390000e-37 167.0
28 TraesCS4B01G348200 chr4D 84.848 165 17 4 3511 3674 499217769 499217926 4.010000e-35 159.0
29 TraesCS4B01G348200 chr5D 87.264 424 40 11 3 415 55048331 55048751 4.530000e-129 472.0
30 TraesCS4B01G348200 chr5D 84.634 423 55 5 3 416 456815686 456815265 2.780000e-111 412.0
31 TraesCS4B01G348200 chr7D 86.824 425 42 8 3 416 535790856 535790435 2.730000e-126 462.0
32 TraesCS4B01G348200 chr6B 97.170 212 6 0 3662 3873 18921874 18922085 3.680000e-95 359.0
33 TraesCS4B01G348200 chr6B 90.196 51 2 3 3626 3675 657283178 657283130 3.230000e-06 63.9
34 TraesCS4B01G348200 chr3B 95.928 221 7 2 3654 3873 105031596 105031377 1.320000e-94 357.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G348200 chr4B 641567556 641571428 3872 False 7153.000000 7153 100.000000 1 3873 1 chr4B.!!$F3 3872
1 TraesCS4B01G348200 chr4B 641684843 641688719 3876 False 6996.000000 6996 99.253000 1 3873 1 chr4B.!!$F7 3872
2 TraesCS4B01G348200 chr4B 641608737 641612614 3877 False 6974.000000 6974 99.150000 1 3873 1 chr4B.!!$F5 3872
3 TraesCS4B01G348200 chr4B 641776510 641780378 3868 False 6722.000000 6722 98.024000 1 3873 1 chr4B.!!$F10 3872
4 TraesCS4B01G348200 chr4B 641645441 641649345 3904 False 3552.500000 6460 98.846500 1 3873 2 chr4B.!!$F13 3872
5 TraesCS4B01G348200 chr4B 641521619 641524103 2484 False 3546.000000 3546 92.688000 933 3379 1 chr4B.!!$F2 2446
6 TraesCS4B01G348200 chr4B 641540605 641544381 3776 False 1996.500000 3675 86.436500 465 3376 2 chr4B.!!$F12 2911
7 TraesCS4B01G348200 chr4B 641740054 641740955 901 False 1485.000000 1485 96.785000 2993 3873 1 chr4B.!!$F9 880
8 TraesCS4B01G348200 chr4B 641481931 641485053 3122 False 1478.233333 4193 91.956000 492 3674 3 chr4B.!!$F11 3182
9 TraesCS4B01G348200 chr5A 679777716 679780696 2980 False 1887.250000 3718 93.104500 426 3470 2 chr5A.!!$F1 3044
10 TraesCS4B01G348200 chrUn 410173695 410175031 1336 True 2436.000000 2436 99.551000 1020 2356 1 chrUn.!!$R1 1336
11 TraesCS4B01G348200 chrUn 421756176 421757029 853 False 1561.000000 1561 99.649000 1 854 1 chrUn.!!$F1 853
12 TraesCS4B01G348200 chr4D 499167040 499168116 1076 False 374.333333 758 90.343333 426 1568 3 chr4D.!!$F4 1142

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1276 2265 2.610694 CGTCAGGTGCTGCCACAAG 61.611 63.158 0.0 0.0 43.88 3.16 F
2614 3644 2.648059 GGGGTCATCCATTCAGACAAG 58.352 52.381 0.0 0.0 37.22 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2614 3644 0.107459 GGAGGCCTCTTGTGATGTCC 60.107 60.0 31.36 8.71 0.0 4.02 R
3576 4705 2.851263 AAAGCCGGTCACATGTTCTA 57.149 45.0 1.90 0.00 0.0 2.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1276 2265 2.610694 CGTCAGGTGCTGCCACAAG 61.611 63.158 0.0 0.0 43.88 3.16
2614 3644 2.648059 GGGGTCATCCATTCAGACAAG 58.352 52.381 0.0 0.0 37.22 3.16
3193 4259 2.754946 AGACGCCCTCGAATTTTGTA 57.245 45.000 0.0 0.0 39.41 2.41
3205 4271 7.312154 CCTCGAATTTTGTATTGAATCACCAA 58.688 34.615 0.0 0.0 0.00 3.67
3551 4678 1.203065 GCTGTTGCTCTTGTTGTTGC 58.797 50.000 0.0 0.0 36.03 4.17
3552 4679 1.202336 GCTGTTGCTCTTGTTGTTGCT 60.202 47.619 0.0 0.0 36.03 3.91
3553 4680 2.456989 CTGTTGCTCTTGTTGTTGCTG 58.543 47.619 0.0 0.0 0.00 4.41
3576 4705 6.682746 TGTTGTTGTTGTTGTTGTAATCACT 58.317 32.000 0.0 0.0 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1276 2265 0.109723 TGGCCACCCAGTACTTGTTC 59.890 55.000 0.00 0.00 35.79 3.18
2614 3644 0.107459 GGAGGCCTCTTGTGATGTCC 60.107 60.000 31.36 8.71 0.00 4.02
2953 3983 2.254546 TAAGAGCACACAACCCACAG 57.745 50.000 0.00 0.00 0.00 3.66
3193 4259 4.635765 CCTACATCGTGTTGGTGATTCAAT 59.364 41.667 9.30 0.00 38.24 2.57
3205 4271 3.596940 AGGGATACTCCTACATCGTGT 57.403 47.619 0.00 0.00 36.57 4.49
3529 4629 3.450578 CAACAACAAGAGCAACAGCAAT 58.549 40.909 0.00 0.00 0.00 3.56
3551 4678 6.806249 AGTGATTACAACAACAACAACAACAG 59.194 34.615 0.00 0.00 0.00 3.16
3552 4679 6.682746 AGTGATTACAACAACAACAACAACA 58.317 32.000 0.00 0.00 0.00 3.33
3553 4680 8.178964 TCTAGTGATTACAACAACAACAACAAC 58.821 33.333 0.00 0.00 0.00 3.32
3576 4705 2.851263 AAAGCCGGTCACATGTTCTA 57.149 45.000 1.90 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.