Multiple sequence alignment - TraesCS4B01G346800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G346800 chr4B 100.000 2348 0 0 1 2348 640325256 640327603 0.000000e+00 4337
1 TraesCS4B01G346800 chr4B 97.510 241 4 2 1 240 640328887 640328648 6.040000e-111 411
2 TraesCS4B01G346800 chr4B 98.010 201 4 0 1 201 577276388 577276588 1.340000e-92 350
3 TraesCS4B01G346800 chr2B 97.537 2152 39 7 199 2348 448250887 448253026 0.000000e+00 3668
4 TraesCS4B01G346800 chr2A 96.000 2175 53 15 199 2347 510803839 510806005 0.000000e+00 3504
5 TraesCS4B01G346800 chr2A 98.507 201 3 0 1 201 616476622 616476422 2.870000e-94 355
6 TraesCS4B01G346800 chr2A 97.990 199 4 0 1 199 616473976 616473778 1.730000e-91 346
7 TraesCS4B01G346800 chr2D 95.948 2172 52 15 199 2348 376813850 376816007 0.000000e+00 3491
8 TraesCS4B01G346800 chr7A 98.507 201 3 0 1 201 26819575 26819375 2.870000e-94 355
9 TraesCS4B01G346800 chr5B 98.492 199 3 0 1 199 2048086 2048284 3.710000e-93 351
10 TraesCS4B01G346800 chr5B 98.010 201 4 0 1 201 2045440 2045640 1.340000e-92 350
11 TraesCS4B01G346800 chr6A 97.990 199 4 0 1 199 585706656 585706854 1.730000e-91 346
12 TraesCS4B01G346800 chr6D 97.512 201 5 0 1 201 222290897 222290697 6.210000e-91 344


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G346800 chr4B 640325256 640327603 2347 False 4337.0 4337 100.0000 1 2348 1 chr4B.!!$F2 2347
1 TraesCS4B01G346800 chr2B 448250887 448253026 2139 False 3668.0 3668 97.5370 199 2348 1 chr2B.!!$F1 2149
2 TraesCS4B01G346800 chr2A 510803839 510806005 2166 False 3504.0 3504 96.0000 199 2347 1 chr2A.!!$F1 2148
3 TraesCS4B01G346800 chr2A 616473778 616476622 2844 True 350.5 355 98.2485 1 201 2 chr2A.!!$R1 200
4 TraesCS4B01G346800 chr2D 376813850 376816007 2157 False 3491.0 3491 95.9480 199 2348 1 chr2D.!!$F1 2149
5 TraesCS4B01G346800 chr5B 2045440 2048284 2844 False 350.5 351 98.2510 1 201 2 chr5B.!!$F1 200

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
525 757 0.671781 CGCACTTCTCTTCCACCCAG 60.672 60.0 0.0 0.0 0.0 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1812 3193 3.662759 TTCTGGGGTTGACTGTTCTTT 57.337 42.857 0.0 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 4.766373 TGTACGTAAACCTCATGTGACCTA 59.234 41.667 0.00 0.0 0.00 3.08
46 47 3.704566 TGTGACCTAGACCGAAATAGCAT 59.295 43.478 0.00 0.0 0.00 3.79
208 209 2.172505 ACGGGCACATCATCTTCCATTA 59.827 45.455 0.00 0.0 0.00 1.90
370 597 7.733047 TGTGGATTAGAGCCCTTAATATCAGTA 59.267 37.037 0.00 0.0 0.00 2.74
525 757 0.671781 CGCACTTCTCTTCCACCCAG 60.672 60.000 0.00 0.0 0.00 4.45
1134 2291 3.973267 GAGCTCGTGCCTGTCGTCC 62.973 68.421 5.73 0.0 40.80 4.79
1243 2406 2.948354 TCCCCCAGGACGACCCTA 60.948 66.667 0.00 0.0 45.60 3.53
1618 2999 1.501582 AGGCATAGGACCAGACTTCC 58.498 55.000 0.00 0.0 0.00 3.46
1701 3082 5.940470 GGCCGGATGAGTATTATTCTGAAAT 59.060 40.000 5.05 0.0 0.00 2.17
1812 3193 5.735922 GCATACAAAGTGGAGAAAGTGCAAA 60.736 40.000 0.00 0.0 0.00 3.68
1926 3307 5.532664 AAATAATGAGGACTCTACCGACC 57.467 43.478 0.56 0.0 34.73 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 5.693104 GTCACATGAGGTTTACGTACAGAAA 59.307 40.000 0.00 0.00 0.00 2.52
32 33 3.520290 TTGTCGATGCTATTTCGGTCT 57.480 42.857 0.00 0.00 37.22 3.85
46 47 2.288666 GCCAAGCTGGATAATTGTCGA 58.711 47.619 6.40 0.00 40.96 4.20
244 246 7.771183 TCAGTTCTAAAAGTTTGCAAATGACT 58.229 30.769 16.21 5.74 0.00 3.41
370 597 5.570320 TCTTTACCCTAATGAAAGCTTGCT 58.430 37.500 5.89 0.00 31.55 3.91
525 757 9.030301 GTATGGGTTGAATATTTTGTGTTATGC 57.970 33.333 0.00 0.00 0.00 3.14
1134 2291 4.421479 AGGCCGTGCTCGTTCTCG 62.421 66.667 7.47 0.00 38.55 4.04
1618 2999 8.760569 GTCTTGAAAGTAAGAAACAGAAGAGAG 58.239 37.037 0.00 0.00 38.33 3.20
1701 3082 6.431234 TCGCAGAAGCTTGTCTATCATAGATA 59.569 38.462 2.10 0.00 36.42 1.98
1812 3193 3.662759 TTCTGGGGTTGACTGTTCTTT 57.337 42.857 0.00 0.00 0.00 2.52
1923 3304 5.964958 TGATGTCTTTTTCAAGGATGGTC 57.035 39.130 0.00 0.00 0.00 4.02
1926 3307 9.865321 AATTACATGATGTCTTTTTCAAGGATG 57.135 29.630 0.00 0.00 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.