Multiple sequence alignment - TraesCS4B01G343600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G343600 chr4B 100.000 2479 0 0 1 2479 637347289 637344811 0.000000e+00 4578.0
1 TraesCS4B01G343600 chr4B 87.234 188 10 5 2216 2391 146536735 146536920 4.180000e-48 202.0
2 TraesCS4B01G343600 chr4B 94.545 110 6 0 1154 1263 650584440 650584549 1.180000e-38 171.0
3 TraesCS4B01G343600 chr2D 92.868 2005 97 22 65 2052 620322213 620320238 0.000000e+00 2868.0
4 TraesCS4B01G343600 chr1B 98.700 1615 17 3 868 2479 12395810 12394197 0.000000e+00 2863.0
5 TraesCS4B01G343600 chr1B 97.152 632 13 2 41 667 12396442 12395811 0.000000e+00 1062.0
6 TraesCS4B01G343600 chr3B 95.504 1646 47 12 416 2053 299750855 299749229 0.000000e+00 2604.0
7 TraesCS4B01G343600 chr3B 91.277 321 15 5 105 421 299768350 299768039 2.280000e-115 425.0
8 TraesCS4B01G343600 chr7A 88.724 674 54 15 1325 1985 707987774 707988438 0.000000e+00 804.0
9 TraesCS4B01G343600 chr7A 88.077 671 55 15 1327 1985 30225669 30225012 0.000000e+00 773.0
10 TraesCS4B01G343600 chr5A 88.376 671 53 13 1327 1985 608038427 608037770 0.000000e+00 784.0
11 TraesCS4B01G343600 chr5A 80.349 229 21 7 2052 2256 15037952 15038180 4.270000e-33 152.0
12 TraesCS4B01G343600 chr3D 90.123 567 47 7 1419 1985 35703994 35703437 0.000000e+00 728.0
13 TraesCS4B01G343600 chr3D 88.141 624 56 13 1371 1985 35676775 35677389 0.000000e+00 726.0
14 TraesCS4B01G343600 chr6B 85.544 671 63 16 1328 1985 30418061 30417412 0.000000e+00 671.0
15 TraesCS4B01G343600 chr5B 89.150 553 41 12 1325 1867 38456869 38456326 0.000000e+00 671.0
16 TraesCS4B01G343600 chr3A 84.286 210 16 6 2208 2402 736144126 736144333 3.250000e-44 189.0
17 TraesCS4B01G343600 chr3A 82.128 235 25 10 738 960 44580854 44581083 4.210000e-43 185.0
18 TraesCS4B01G343600 chr3A 92.727 110 8 0 1154 1263 44582622 44582513 2.550000e-35 159.0
19 TraesCS4B01G343600 chr3A 92.473 93 7 0 1154 1246 44583471 44583563 1.550000e-27 134.0
20 TraesCS4B01G343600 chr3A 89.855 69 5 2 954 1020 44582839 44582771 1.220000e-13 87.9
21 TraesCS4B01G343600 chr3A 89.706 68 6 1 954 1020 44583277 44583344 4.390000e-13 86.1
22 TraesCS4B01G343600 chr3A 92.683 41 1 1 4 42 73923025 73922985 9.580000e-05 58.4
23 TraesCS4B01G343600 chr5D 93.636 110 7 0 1154 1263 450172210 450172319 5.480000e-37 165.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G343600 chr4B 637344811 637347289 2478 True 4578.0 4578 100.000 1 2479 1 chr4B.!!$R1 2478
1 TraesCS4B01G343600 chr2D 620320238 620322213 1975 True 2868.0 2868 92.868 65 2052 1 chr2D.!!$R1 1987
2 TraesCS4B01G343600 chr1B 12394197 12396442 2245 True 1962.5 2863 97.926 41 2479 2 chr1B.!!$R1 2438
3 TraesCS4B01G343600 chr3B 299749229 299750855 1626 True 2604.0 2604 95.504 416 2053 1 chr3B.!!$R1 1637
4 TraesCS4B01G343600 chr7A 707987774 707988438 664 False 804.0 804 88.724 1325 1985 1 chr7A.!!$F1 660
5 TraesCS4B01G343600 chr7A 30225012 30225669 657 True 773.0 773 88.077 1327 1985 1 chr7A.!!$R1 658
6 TraesCS4B01G343600 chr5A 608037770 608038427 657 True 784.0 784 88.376 1327 1985 1 chr5A.!!$R1 658
7 TraesCS4B01G343600 chr3D 35703437 35703994 557 True 728.0 728 90.123 1419 1985 1 chr3D.!!$R1 566
8 TraesCS4B01G343600 chr3D 35676775 35677389 614 False 726.0 726 88.141 1371 1985 1 chr3D.!!$F1 614
9 TraesCS4B01G343600 chr6B 30417412 30418061 649 True 671.0 671 85.544 1328 1985 1 chr6B.!!$R1 657
10 TraesCS4B01G343600 chr5B 38456326 38456869 543 True 671.0 671 89.150 1325 1867 1 chr5B.!!$R1 542

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
71 72 2.671396 ACTGTTACGATGATTGGCGAAC 59.329 45.455 0.0 0.0 0.0 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2049 2081 0.552848 TCCAGAAATCCATGCTCCCC 59.447 55.0 0.0 0.0 0.0 4.81 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 2.671396 ACTGTTACGATGATTGGCGAAC 59.329 45.455 0.00 0.0 0.00 3.95
141 147 7.118101 ACGGCGAGTTACAAAATAAGAATTACA 59.882 33.333 16.62 0.0 30.46 2.41
754 766 7.093421 ACCCTCTGTATCAGTACTAGTTTTTCC 60.093 40.741 0.00 0.0 32.61 3.13
783 795 5.755409 TTCTACCACACTGTTCATATGGT 57.245 39.130 2.13 0.0 45.56 3.55
834 846 8.873830 CATATTTGTCGTTCTATTGTGAAGTCT 58.126 33.333 0.00 0.0 0.00 3.24
899 911 6.749923 ATCTTTCAGATTTCAGTACAAGGC 57.250 37.500 0.00 0.0 28.69 4.35
1047 1061 1.212375 AGGCCCTTTGGTTTGCTTTT 58.788 45.000 0.00 0.0 0.00 2.27
1737 1766 4.100189 CCAGAATCCGGACAGAAATCTAGT 59.900 45.833 6.12 0.0 0.00 2.57
2132 2164 3.681897 CCTTCTGTTCCTTGAGATTGACG 59.318 47.826 0.00 0.0 0.00 4.35
2246 2278 5.830799 TGCCTATCCACTGTTGATGATAT 57.169 39.130 4.75 0.0 0.00 1.63
2277 2309 4.331168 GCACAACTGCATAAAACAAAACCA 59.669 37.500 0.00 0.0 43.62 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 9.905713 ACAGTTGTAACATATCAAATGGTATCT 57.094 29.630 9.42 0.00 41.71 1.98
32 33 8.447833 CGTAACAGTTGTAACATATCAAATGGT 58.552 33.333 9.42 5.89 41.71 3.55
33 34 8.661257 TCGTAACAGTTGTAACATATCAAATGG 58.339 33.333 9.42 0.00 41.71 3.16
36 37 9.425577 TCATCGTAACAGTTGTAACATATCAAA 57.574 29.630 0.00 0.00 0.00 2.69
37 38 8.989653 TCATCGTAACAGTTGTAACATATCAA 57.010 30.769 0.00 0.00 0.00 2.57
38 39 9.594478 AATCATCGTAACAGTTGTAACATATCA 57.406 29.630 0.00 0.00 0.00 2.15
39 40 9.849607 CAATCATCGTAACAGTTGTAACATATC 57.150 33.333 0.00 0.00 0.00 1.63
44 45 5.321516 GCCAATCATCGTAACAGTTGTAAC 58.678 41.667 0.00 0.00 0.00 2.50
71 72 0.909623 AAGGTGGATGGACGGGTAAG 59.090 55.000 0.00 0.00 0.00 2.34
141 147 7.386848 CGGTCCCATCGTTATATGTAATTTCTT 59.613 37.037 0.00 0.00 0.00 2.52
159 165 0.397564 AAAACGTGTACCGGTCCCAT 59.602 50.000 12.40 0.00 42.24 4.00
213 219 4.519350 ACCGAAGAGAAAATTTCCAAGACC 59.481 41.667 1.57 0.00 0.00 3.85
834 846 8.754991 TTTTGTAGGAAGAAATAGGAAACACA 57.245 30.769 0.00 0.00 0.00 3.72
889 901 2.061773 CTGAAGTGTCGCCTTGTACTG 58.938 52.381 0.00 0.00 0.00 2.74
899 911 7.993821 ACTATGTCAATATTCTGAAGTGTCG 57.006 36.000 0.00 0.00 0.00 4.35
1047 1061 3.295973 CCAAAGACCAGTTCCAGGAAAA 58.704 45.455 2.45 0.00 0.00 2.29
1737 1766 5.353111 TCGCTCGATAAACATCATTGGTTA 58.647 37.500 0.00 0.00 39.29 2.85
2049 2081 0.552848 TCCAGAAATCCATGCTCCCC 59.447 55.000 0.00 0.00 0.00 4.81
2101 2133 2.839228 AGGAACAGAAGGCTAGTGGAT 58.161 47.619 0.00 0.00 0.00 3.41
2132 2164 2.160417 GCATGAACTTGTCTGTAGTGGC 59.840 50.000 0.00 0.00 0.00 5.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.