Multiple sequence alignment - TraesCS4B01G333000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G333000 chr4B 100.000 2314 0 0 1 2314 623334091 623331778 0.000000e+00 4274
1 TraesCS4B01G333000 chrUn 98.230 2317 36 5 2 2314 170995033 170992718 0.000000e+00 4047
2 TraesCS4B01G333000 chr7B 98.145 2318 39 4 1 2314 644446410 644448727 0.000000e+00 4039
3 TraesCS4B01G333000 chr7B 98.102 2318 40 4 1 2314 743095873 743098190 0.000000e+00 4034
4 TraesCS4B01G333000 chr7B 96.851 2318 67 6 1 2314 54063137 54065452 0.000000e+00 3871
5 TraesCS4B01G333000 chr6B 97.886 2318 44 5 1 2314 307014540 307012224 0.000000e+00 4004
6 TraesCS4B01G333000 chr6B 97.066 2318 63 5 1 2314 264960613 264962929 0.000000e+00 3899
7 TraesCS4B01G333000 chr1A 97.282 2318 58 5 1 2314 94677201 94679517 0.000000e+00 3927
8 TraesCS4B01G333000 chr1B 97.239 2318 59 5 1 2314 672527985 672525669 0.000000e+00 3921
9 TraesCS4B01G333000 chr7D 98.213 2239 38 2 1 2237 626724463 626726701 0.000000e+00 3912
10 TraesCS4B01G333000 chr5B 95.000 80 3 1 2236 2314 284073967 284074046 8.680000e-25 124


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G333000 chr4B 623331778 623334091 2313 True 4274 4274 100.000 1 2314 1 chr4B.!!$R1 2313
1 TraesCS4B01G333000 chrUn 170992718 170995033 2315 True 4047 4047 98.230 2 2314 1 chrUn.!!$R1 2312
2 TraesCS4B01G333000 chr7B 644446410 644448727 2317 False 4039 4039 98.145 1 2314 1 chr7B.!!$F2 2313
3 TraesCS4B01G333000 chr7B 743095873 743098190 2317 False 4034 4034 98.102 1 2314 1 chr7B.!!$F3 2313
4 TraesCS4B01G333000 chr7B 54063137 54065452 2315 False 3871 3871 96.851 1 2314 1 chr7B.!!$F1 2313
5 TraesCS4B01G333000 chr6B 307012224 307014540 2316 True 4004 4004 97.886 1 2314 1 chr6B.!!$R1 2313
6 TraesCS4B01G333000 chr6B 264960613 264962929 2316 False 3899 3899 97.066 1 2314 1 chr6B.!!$F1 2313
7 TraesCS4B01G333000 chr1A 94677201 94679517 2316 False 3927 3927 97.282 1 2314 1 chr1A.!!$F1 2313
8 TraesCS4B01G333000 chr1B 672525669 672527985 2316 True 3921 3921 97.239 1 2314 1 chr1B.!!$R1 2313
9 TraesCS4B01G333000 chr7D 626724463 626726701 2238 False 3912 3912 98.213 1 2237 1 chr7D.!!$F1 2236

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
741 744 1.511613 ATAGGTATGGTGTGCAGGCT 58.488 50.0 0.0 0.0 0.0 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2021 2028 3.337358 TGAGCGAGATTGATTGAAAGCA 58.663 40.909 0.0 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 221 8.801299 TGAATTAACAAATATGAAGCAAGACCA 58.199 29.630 0.00 0.00 0.00 4.02
325 327 8.677148 AATAACACATAAATCGAAGGCTATGT 57.323 30.769 0.00 0.00 35.80 2.29
473 476 2.840066 CGAATCGAGCGAGCTCCCT 61.840 63.158 18.19 3.84 39.77 4.20
618 621 4.326826 CTGGCAAAAGAAGTATGGTCTCA 58.673 43.478 0.00 0.00 0.00 3.27
741 744 1.511613 ATAGGTATGGTGTGCAGGCT 58.488 50.000 0.00 0.00 0.00 4.58
1012 1016 1.988982 TACCCATATGCAAGGCGCCA 61.989 55.000 31.54 8.23 41.33 5.69
1032 1036 1.298953 TCTTAGCCTTGCCTTCCCAT 58.701 50.000 0.00 0.00 0.00 4.00
1077 1081 1.112113 GTGATCGGCCTCCTCAACTA 58.888 55.000 0.00 0.00 0.00 2.24
1234 1238 3.665675 AACTGCAGCGTCCGGATCC 62.666 63.158 15.27 0.00 0.00 3.36
1258 1262 6.096036 CGATCTATCTACTCGGCAATTCATT 58.904 40.000 0.00 0.00 0.00 2.57
1270 1274 3.129287 GGCAATTCATTCGGTGACTTCAT 59.871 43.478 0.00 0.00 36.32 2.57
1435 1439 4.080807 TGGTCATTATAGCGGTTCCTTCAA 60.081 41.667 0.00 0.00 0.00 2.69
1733 1739 0.617935 TTGCCGACTCATTCCATCCA 59.382 50.000 0.00 0.00 0.00 3.41
1869 1876 4.759693 TCGTTGGTGCATAACAGATCTTTT 59.240 37.500 14.57 0.00 0.00 2.27
2186 2193 9.639601 TCTATCGTAAAATTCTATATGCCACAG 57.360 33.333 0.00 0.00 0.00 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 221 1.308216 CCTGGGATGGGAGGGAGTT 60.308 63.158 0.00 0.00 0.00 3.01
317 319 2.324541 GTCTGAGGATCCACATAGCCT 58.675 52.381 15.82 0.00 38.19 4.58
325 327 7.458806 TCCATTTCATATATGTCTGAGGATCCA 59.541 37.037 15.82 0.00 0.00 3.41
473 476 2.314246 TCACCACCACATCATTGCAAA 58.686 42.857 1.71 0.00 0.00 3.68
543 546 0.814010 AAGTTGGTGAGCCGTGTGAC 60.814 55.000 0.00 0.00 37.67 3.67
618 621 2.689983 CACTTGAGTGGCAAAGGAAAGT 59.310 45.455 3.19 0.54 42.10 2.66
741 744 3.202151 CACCTAAAATCCAAGGGAGGCTA 59.798 47.826 0.00 0.00 37.18 3.93
1012 1016 1.298953 TGGGAAGGCAAGGCTAAGAT 58.701 50.000 0.00 0.00 0.00 2.40
1032 1036 1.888436 GACAGGTGTGGGAGCGATCA 61.888 60.000 1.84 0.00 0.00 2.92
1077 1081 2.289072 CCCTGCCTTTCGATCGATACAT 60.289 50.000 20.18 0.00 0.00 2.29
1234 1238 5.048153 TGAATTGCCGAGTAGATAGATCG 57.952 43.478 0.00 0.00 36.24 3.69
1258 1262 1.080093 GCGACCATGAAGTCACCGA 60.080 57.895 0.00 0.00 36.52 4.69
1270 1274 2.282180 GGGCTTCTTTGGCGACCA 60.282 61.111 0.00 0.00 0.00 4.02
1532 1538 0.109597 GCCGCTTGAACATTGTCTGG 60.110 55.000 0.00 0.00 0.00 3.86
1869 1876 4.213694 GCACCGAGAAAGATCGTAGATAGA 59.786 45.833 0.00 0.00 45.12 1.98
2021 2028 3.337358 TGAGCGAGATTGATTGAAAGCA 58.663 40.909 0.00 0.00 0.00 3.91
2186 2193 9.691362 CTGCTAGGATTTCTTTCTACTTCTATC 57.309 37.037 0.00 0.00 0.00 2.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.