Multiple sequence alignment - TraesCS4B01G318100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G318100 chr4B 100.000 2677 0 0 1 2677 608654884 608657560 0 4944
1 TraesCS4B01G318100 chr4B 94.300 2684 113 20 1 2677 603283650 603286300 0 4072
2 TraesCS4B01G318100 chr2B 98.584 2683 30 5 1 2677 658217247 658219927 0 4737
3 TraesCS4B01G318100 chr2B 95.235 2686 86 24 1 2677 19859430 19856778 0 4213
4 TraesCS4B01G318100 chr2B 95.775 2059 70 10 1 2052 512418649 512420697 0 3304
5 TraesCS4B01G318100 chr2B 95.105 2043 66 17 1 2034 790121912 790123929 0 3188
6 TraesCS4B01G318100 chr2B 92.783 1538 67 18 1141 2677 670333496 670332002 0 2185
7 TraesCS4B01G318100 chr7B 98.546 2683 31 5 1 2677 693181431 693178751 0 4732
8 TraesCS4B01G318100 chr7B 97.951 2684 34 6 1 2677 180020835 180023504 0 4632
9 TraesCS4B01G318100 chr3B 98.025 2683 46 4 1 2677 754466320 754463639 0 4654
10 TraesCS4B01G318100 chr3B 93.043 1538 75 18 1141 2677 657795923 657794417 0 2218
11 TraesCS4B01G318100 chrUn 95.568 2685 92 17 1 2677 76246647 76243982 0 4274
12 TraesCS4B01G318100 chr6B 95.045 2684 88 20 1 2677 353544804 353547449 0 4178
13 TraesCS4B01G318100 chr6B 94.004 2685 99 23 1 2677 319478563 319475933 0 4010


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G318100 chr4B 608654884 608657560 2676 False 4944 4944 100.000 1 2677 1 chr4B.!!$F2 2676
1 TraesCS4B01G318100 chr4B 603283650 603286300 2650 False 4072 4072 94.300 1 2677 1 chr4B.!!$F1 2676
2 TraesCS4B01G318100 chr2B 658217247 658219927 2680 False 4737 4737 98.584 1 2677 1 chr2B.!!$F2 2676
3 TraesCS4B01G318100 chr2B 19856778 19859430 2652 True 4213 4213 95.235 1 2677 1 chr2B.!!$R1 2676
4 TraesCS4B01G318100 chr2B 512418649 512420697 2048 False 3304 3304 95.775 1 2052 1 chr2B.!!$F1 2051
5 TraesCS4B01G318100 chr2B 790121912 790123929 2017 False 3188 3188 95.105 1 2034 1 chr2B.!!$F3 2033
6 TraesCS4B01G318100 chr2B 670332002 670333496 1494 True 2185 2185 92.783 1141 2677 1 chr2B.!!$R2 1536
7 TraesCS4B01G318100 chr7B 693178751 693181431 2680 True 4732 4732 98.546 1 2677 1 chr7B.!!$R1 2676
8 TraesCS4B01G318100 chr7B 180020835 180023504 2669 False 4632 4632 97.951 1 2677 1 chr7B.!!$F1 2676
9 TraesCS4B01G318100 chr3B 754463639 754466320 2681 True 4654 4654 98.025 1 2677 1 chr3B.!!$R2 2676
10 TraesCS4B01G318100 chr3B 657794417 657795923 1506 True 2218 2218 93.043 1141 2677 1 chr3B.!!$R1 1536
11 TraesCS4B01G318100 chrUn 76243982 76246647 2665 True 4274 4274 95.568 1 2677 1 chrUn.!!$R1 2676
12 TraesCS4B01G318100 chr6B 353544804 353547449 2645 False 4178 4178 95.045 1 2677 1 chr6B.!!$F1 2676
13 TraesCS4B01G318100 chr6B 319475933 319478563 2630 True 4010 4010 94.004 1 2677 1 chr6B.!!$R1 2676

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
694 701 5.738619 AGGCAAATTACGGAAGGATTTTT 57.261 34.783 0.0 0.0 31.52 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2327 2365 0.877743 GAGTTTGAGTTGCCTGGCTC 59.122 55.0 21.03 12.81 0.0 4.7 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
366 367 9.979578 CTATAATGAGAAGAAAGTCTACATGCT 57.020 33.333 0.00 0.0 0.00 3.79
694 701 5.738619 AGGCAAATTACGGAAGGATTTTT 57.261 34.783 0.00 0.0 31.52 1.94
930 941 6.753107 AAGCAACTAACAGTGTAGTTTTGT 57.247 33.333 12.57 0.0 41.38 2.83
986 997 7.752239 GTCATGGTCATGTCTGTATTCTTTTTG 59.248 37.037 10.32 0.0 39.72 2.44
993 1004 7.284261 TCATGTCTGTATTCTTTTTGACACCAA 59.716 33.333 0.00 0.0 37.28 3.67
1604 1630 4.221703 CGGTCTCTATGGGAAGAGCATTAT 59.778 45.833 0.00 0.0 42.36 1.28
1914 1947 3.826157 TCCAAGCATAAGGAAACAGTTGG 59.174 43.478 0.00 0.0 35.52 3.77
1984 2017 5.692204 GCATACTCAAGTTAGCGTATGTCAT 59.308 40.000 14.60 0.0 40.61 3.06
2501 2539 6.429692 CACTGTTTGACCATTACACCAATCTA 59.570 38.462 0.00 0.0 0.00 1.98
2552 2590 4.002982 CAGAACCACAATAGCTGCACTTA 58.997 43.478 1.02 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
366 367 4.764823 ACAATCTATTTGCTTCGGGTTTGA 59.235 37.500 0.00 0.00 39.03 2.69
606 609 5.943416 TGTCAAGGAGAGACTGTTTCAAAAA 59.057 36.000 0.94 0.00 36.94 1.94
986 997 3.988379 TTTGCATCTGAACTTGGTGTC 57.012 42.857 0.00 0.00 0.00 3.67
993 1004 5.733620 ATTCCATGTTTTGCATCTGAACT 57.266 34.783 0.00 0.00 35.19 3.01
1256 1272 2.954989 TGCTTGTGTGAGTAATTTGCCA 59.045 40.909 0.00 0.00 0.00 4.92
1604 1630 2.741092 GAGACACGGGAACTGGCA 59.259 61.111 0.00 0.00 40.47 4.92
1737 1770 4.762765 TGTAGTAGCTAGCTTCCTCTATGC 59.237 45.833 24.88 5.66 0.00 3.14
1914 1947 0.878416 TTGTCAACCCACGCATTAGC 59.122 50.000 0.00 0.00 37.42 3.09
2327 2365 0.877743 GAGTTTGAGTTGCCTGGCTC 59.122 55.000 21.03 12.81 0.00 4.70
2329 2367 2.079925 CTAGAGTTTGAGTTGCCTGGC 58.920 52.381 12.87 12.87 0.00 4.85
2438 2476 6.573664 AAAGATGTGTCGAATGGAATTGAA 57.426 33.333 0.00 0.00 36.07 2.69
2501 2539 2.085343 ATGGTGGAAGCTGCCCAACT 62.085 55.000 20.25 7.12 41.85 3.16
2552 2590 2.941720 GCTGCATCCGAAGAGAAAGAAT 59.058 45.455 0.00 0.00 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.