Multiple sequence alignment - TraesCS4B01G304100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G304100 chr4B 100.000 2570 0 0 1 2570 592188300 592185731 0.000000e+00 4747.0
1 TraesCS4B01G304100 chr4B 97.628 2530 43 6 57 2570 592079808 592077280 0.000000e+00 4324.0
2 TraesCS4B01G304100 chr4B 95.634 1191 51 1 239 1429 591955071 591953882 0.000000e+00 1910.0
3 TraesCS4B01G304100 chr4B 90.165 1332 111 10 131 1442 591909491 591908160 0.000000e+00 1716.0
4 TraesCS4B01G304100 chr4B 91.818 220 15 2 1 217 591956190 591955971 1.160000e-78 303.0
5 TraesCS4B01G304100 chr4A 93.381 1662 81 7 8 1641 677989127 677987467 0.000000e+00 2433.0
6 TraesCS4B01G304100 chr4A 90.378 1455 92 19 2 1430 677969767 677968335 0.000000e+00 1868.0
7 TraesCS4B01G304100 chr4A 90.634 1324 99 12 131 1433 677958657 677957338 0.000000e+00 1735.0
8 TraesCS4B01G304100 chr4A 85.149 101 8 4 1 98 677976057 677975961 2.100000e-16 97.1
9 TraesCS4B01G304100 chr4D 93.902 1443 74 7 1 1429 470138628 470137186 0.000000e+00 2165.0
10 TraesCS4B01G304100 chr4D 91.944 1440 89 8 4 1429 470130583 470129157 0.000000e+00 1991.0
11 TraesCS4B01G304100 chr4D 90.430 1327 99 14 131 1433 470121979 470120657 0.000000e+00 1722.0
12 TraesCS4B01G304100 chr4D 83.867 874 87 9 1746 2570 459064506 459065374 0.000000e+00 784.0
13 TraesCS4B01G304100 chr5D 85.439 831 94 14 1746 2570 62242617 62241808 0.000000e+00 839.0
14 TraesCS4B01G304100 chr5D 82.726 851 110 22 1748 2570 62527511 62526670 0.000000e+00 723.0
15 TraesCS4B01G304100 chr5D 82.479 839 122 14 1748 2569 54096460 54095630 0.000000e+00 712.0
16 TraesCS4B01G304100 chr5D 82.270 846 111 20 1746 2561 350760375 350759539 0.000000e+00 695.0
17 TraesCS4B01G304100 chr7B 83.890 838 115 15 1748 2569 376441171 376442004 0.000000e+00 782.0
18 TraesCS4B01G304100 chr7B 83.880 701 101 11 1876 2570 672645755 672646449 0.000000e+00 658.0
19 TraesCS4B01G304100 chr2D 83.353 859 111 20 1741 2570 552066945 552067800 0.000000e+00 765.0
20 TraesCS4B01G304100 chr5A 83.450 858 104 9 1748 2570 69218182 69219036 0.000000e+00 763.0
21 TraesCS4B01G304100 chr5A 84.505 768 91 8 1830 2570 472500257 472499491 0.000000e+00 734.0
22 TraesCS4B01G304100 chr5A 84.915 590 76 11 1745 2333 126433365 126433942 3.680000e-163 584.0
23 TraesCS4B01G304100 chr2B 82.706 850 112 12 1748 2570 576807695 576806854 0.000000e+00 723.0
24 TraesCS4B01G304100 chr6D 83.627 794 92 16 1813 2570 435711151 435710360 0.000000e+00 712.0
25 TraesCS4B01G304100 chr7D 86.804 485 51 11 1748 2224 623704467 623703988 1.750000e-146 529.0
26 TraesCS4B01G304100 chr1D 86.517 356 44 2 2218 2570 309582972 309583326 3.100000e-104 388.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G304100 chr4B 592185731 592188300 2569 True 4747.0 4747 100.000 1 2570 1 chr4B.!!$R3 2569
1 TraesCS4B01G304100 chr4B 592077280 592079808 2528 True 4324.0 4324 97.628 57 2570 1 chr4B.!!$R2 2513
2 TraesCS4B01G304100 chr4B 591908160 591909491 1331 True 1716.0 1716 90.165 131 1442 1 chr4B.!!$R1 1311
3 TraesCS4B01G304100 chr4B 591953882 591956190 2308 True 1106.5 1910 93.726 1 1429 2 chr4B.!!$R4 1428
4 TraesCS4B01G304100 chr4A 677987467 677989127 1660 True 2433.0 2433 93.381 8 1641 1 chr4A.!!$R4 1633
5 TraesCS4B01G304100 chr4A 677968335 677969767 1432 True 1868.0 1868 90.378 2 1430 1 chr4A.!!$R2 1428
6 TraesCS4B01G304100 chr4A 677957338 677958657 1319 True 1735.0 1735 90.634 131 1433 1 chr4A.!!$R1 1302
7 TraesCS4B01G304100 chr4D 470137186 470138628 1442 True 2165.0 2165 93.902 1 1429 1 chr4D.!!$R3 1428
8 TraesCS4B01G304100 chr4D 470129157 470130583 1426 True 1991.0 1991 91.944 4 1429 1 chr4D.!!$R2 1425
9 TraesCS4B01G304100 chr4D 470120657 470121979 1322 True 1722.0 1722 90.430 131 1433 1 chr4D.!!$R1 1302
10 TraesCS4B01G304100 chr4D 459064506 459065374 868 False 784.0 784 83.867 1746 2570 1 chr4D.!!$F1 824
11 TraesCS4B01G304100 chr5D 62241808 62242617 809 True 839.0 839 85.439 1746 2570 1 chr5D.!!$R2 824
12 TraesCS4B01G304100 chr5D 62526670 62527511 841 True 723.0 723 82.726 1748 2570 1 chr5D.!!$R3 822
13 TraesCS4B01G304100 chr5D 54095630 54096460 830 True 712.0 712 82.479 1748 2569 1 chr5D.!!$R1 821
14 TraesCS4B01G304100 chr5D 350759539 350760375 836 True 695.0 695 82.270 1746 2561 1 chr5D.!!$R4 815
15 TraesCS4B01G304100 chr7B 376441171 376442004 833 False 782.0 782 83.890 1748 2569 1 chr7B.!!$F1 821
16 TraesCS4B01G304100 chr7B 672645755 672646449 694 False 658.0 658 83.880 1876 2570 1 chr7B.!!$F2 694
17 TraesCS4B01G304100 chr2D 552066945 552067800 855 False 765.0 765 83.353 1741 2570 1 chr2D.!!$F1 829
18 TraesCS4B01G304100 chr5A 69218182 69219036 854 False 763.0 763 83.450 1748 2570 1 chr5A.!!$F1 822
19 TraesCS4B01G304100 chr5A 472499491 472500257 766 True 734.0 734 84.505 1830 2570 1 chr5A.!!$R1 740
20 TraesCS4B01G304100 chr5A 126433365 126433942 577 False 584.0 584 84.915 1745 2333 1 chr5A.!!$F2 588
21 TraesCS4B01G304100 chr2B 576806854 576807695 841 True 723.0 723 82.706 1748 2570 1 chr2B.!!$R1 822
22 TraesCS4B01G304100 chr6D 435710360 435711151 791 True 712.0 712 83.627 1813 2570 1 chr6D.!!$R1 757

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
991 1894 0.107993 CTCCACGGTCATGCAGATGT 60.108 55.0 0.0 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2296 3296 3.775654 CACCGTGGGAGGGAGAGC 61.776 72.222 0.0 0.0 35.02 4.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 79 6.197096 CGTTAACTGTTACGTGTGTACTTCTT 59.803 38.462 0.00 0.00 33.33 2.52
72 80 7.550494 GTTAACTGTTACGTGTGTACTTCTTC 58.450 38.462 0.00 0.00 0.00 2.87
84 92 3.838903 TGTACTTCTTCCCTCCTTCCTTC 59.161 47.826 0.00 0.00 0.00 3.46
192 202 1.069668 TCATCACCATCTGGAGCATCG 59.930 52.381 2.55 0.00 38.94 3.84
195 205 1.554617 TCACCATCTGGAGCATCGAAA 59.445 47.619 2.55 0.00 38.94 3.46
214 224 0.178961 AAACCAGGAGCCTCCAAACC 60.179 55.000 14.46 0.00 39.61 3.27
265 1168 2.617308 CTCAGCTTCATGGCAACCATAG 59.383 50.000 0.00 0.00 43.15 2.23
309 1212 1.845809 AAGAAGCAGCAAAGACGCCG 61.846 55.000 0.00 0.00 0.00 6.46
501 1404 3.473647 CAGATCTCCGGCTGGCCA 61.474 66.667 6.73 4.71 35.37 5.36
991 1894 0.107993 CTCCACGGTCATGCAGATGT 60.108 55.000 0.00 0.00 0.00 3.06
1332 2235 0.742505 CCTCCTACATGTACGGCGAA 59.257 55.000 16.62 0.00 0.00 4.70
1707 2633 3.510360 TGACTTCAAACGGGGTTTCAAAA 59.490 39.130 0.00 0.00 33.10 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 79 2.986019 TCAAACATGAAGGAAGGAGGGA 59.014 45.455 0.00 0.00 0.00 4.20
72 80 3.084786 GTCAAACATGAAGGAAGGAGGG 58.915 50.000 0.00 0.00 0.00 4.30
84 92 9.436957 AATTAGTAAGTAGGTGAGTCAAACATG 57.563 33.333 0.00 0.00 0.00 3.21
129 137 5.544682 ACAGGGTTGGAGGGTTTATATAGA 58.455 41.667 0.00 0.00 0.00 1.98
192 202 1.995376 TTGGAGGCTCCTGGTTTTTC 58.005 50.000 32.28 4.91 37.46 2.29
195 205 0.178961 GGTTTGGAGGCTCCTGGTTT 60.179 55.000 32.28 0.00 37.46 3.27
265 1168 1.449246 CTGGACTGGCACTAGCAGC 60.449 63.158 0.00 0.00 44.61 5.25
328 1231 4.592192 CGTCGAGGCGGCCATGAT 62.592 66.667 23.09 0.00 0.00 2.45
1332 2235 1.546548 GCCTTCTTCTGCTGGACCTTT 60.547 52.381 0.00 0.00 0.00 3.11
1532 2457 3.911661 AGCACTTGATTTTCTCTGTGC 57.088 42.857 7.69 7.69 46.00 4.57
2296 3296 3.775654 CACCGTGGGAGGGAGAGC 61.776 72.222 0.00 0.00 35.02 4.09


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.