Multiple sequence alignment - TraesCS4B01G304000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G304000 chr4B 100.000 2627 0 0 1 2627 592156252 592153626 0.000000e+00 4852.0
1 TraesCS4B01G304000 chr4B 98.131 1498 28 0 1130 2627 592031412 592029915 0.000000e+00 2612.0
2 TraesCS4B01G304000 chr4B 97.529 1133 23 3 1 1129 592032849 592031718 0.000000e+00 1932.0
3 TraesCS4B01G304000 chr4B 96.919 779 22 2 1 777 107386410 107387188 0.000000e+00 1304.0
4 TraesCS4B01G304000 chr4B 96.791 779 23 2 1 777 465447238 465446460 0.000000e+00 1299.0
5 TraesCS4B01G304000 chr4B 96.787 778 24 1 1 777 23606373 23605596 0.000000e+00 1297.0
6 TraesCS4B01G304000 chr3D 95.323 1860 56 9 776 2627 134599598 134597762 0.000000e+00 2924.0
7 TraesCS4B01G304000 chr3D 95.072 1867 66 10 770 2627 593933528 593935377 0.000000e+00 2915.0
8 TraesCS4B01G304000 chr3D 94.946 1860 63 9 776 2627 365842307 365840471 0.000000e+00 2885.0
9 TraesCS4B01G304000 chr3D 95.787 1614 54 5 1018 2627 535654891 535656494 0.000000e+00 2591.0
10 TraesCS4B01G304000 chr2D 94.751 1867 71 14 768 2627 472192680 472190834 0.000000e+00 2880.0
11 TraesCS4B01G304000 chr2D 88.119 101 7 5 772 869 274371023 274370925 5.940000e-22 115.0
12 TraesCS4B01G304000 chr2D 88.095 84 7 3 775 857 79523370 79523289 2.150000e-16 97.1
13 TraesCS4B01G304000 chr6D 96.190 1575 49 2 1055 2627 466182370 466183935 0.000000e+00 2566.0
14 TraesCS4B01G304000 chr6D 97.192 1460 39 1 1170 2627 47793110 47794569 0.000000e+00 2468.0
15 TraesCS4B01G304000 chr6D 92.531 241 14 2 887 1123 47792744 47792984 2.500000e-90 342.0
16 TraesCS4B01G304000 chr6D 95.455 66 3 0 770 835 468637756 468637821 3.580000e-19 106.0
17 TraesCS4B01G304000 chr5D 96.950 1508 45 1 1121 2627 100988722 100990229 0.000000e+00 2529.0
18 TraesCS4B01G304000 chr4A 95.818 837 32 3 1 835 716723765 716724600 0.000000e+00 1349.0
19 TraesCS4B01G304000 chr7B 97.172 778 21 1 1 777 134178086 134178863 0.000000e+00 1314.0
20 TraesCS4B01G304000 chr5B 97.047 779 21 2 1 777 554278571 554279349 0.000000e+00 1310.0
21 TraesCS4B01G304000 chr6B 96.915 778 23 1 1 777 694136322 694137099 0.000000e+00 1303.0
22 TraesCS4B01G304000 chr3B 96.791 779 23 2 1 777 556553178 556552400 0.000000e+00 1299.0
23 TraesCS4B01G304000 chr3B 93.029 373 22 3 775 1144 13052270 13052641 2.300000e-150 542.0
24 TraesCS4B01G304000 chr7D 92.403 566 30 2 887 1452 162134549 162135101 0.000000e+00 795.0
25 TraesCS4B01G304000 chr2A 90.000 420 28 6 848 1266 659088669 659088263 4.980000e-147 531.0
26 TraesCS4B01G304000 chr2B 94.624 93 4 1 768 859 616504668 616504760 2.730000e-30 143.0
27 TraesCS4B01G304000 chr1B 95.588 68 2 1 769 835 239173972 239173905 9.940000e-20 108.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G304000 chr4B 592153626 592156252 2626 True 4852 4852 100.0000 1 2627 1 chr4B.!!$R3 2626
1 TraesCS4B01G304000 chr4B 592029915 592032849 2934 True 2272 2612 97.8300 1 2627 2 chr4B.!!$R4 2626
2 TraesCS4B01G304000 chr4B 107386410 107387188 778 False 1304 1304 96.9190 1 777 1 chr4B.!!$F1 776
3 TraesCS4B01G304000 chr4B 465446460 465447238 778 True 1299 1299 96.7910 1 777 1 chr4B.!!$R2 776
4 TraesCS4B01G304000 chr4B 23605596 23606373 777 True 1297 1297 96.7870 1 777 1 chr4B.!!$R1 776
5 TraesCS4B01G304000 chr3D 134597762 134599598 1836 True 2924 2924 95.3230 776 2627 1 chr3D.!!$R1 1851
6 TraesCS4B01G304000 chr3D 593933528 593935377 1849 False 2915 2915 95.0720 770 2627 1 chr3D.!!$F2 1857
7 TraesCS4B01G304000 chr3D 365840471 365842307 1836 True 2885 2885 94.9460 776 2627 1 chr3D.!!$R2 1851
8 TraesCS4B01G304000 chr3D 535654891 535656494 1603 False 2591 2591 95.7870 1018 2627 1 chr3D.!!$F1 1609
9 TraesCS4B01G304000 chr2D 472190834 472192680 1846 True 2880 2880 94.7510 768 2627 1 chr2D.!!$R3 1859
10 TraesCS4B01G304000 chr6D 466182370 466183935 1565 False 2566 2566 96.1900 1055 2627 1 chr6D.!!$F1 1572
11 TraesCS4B01G304000 chr6D 47792744 47794569 1825 False 1405 2468 94.8615 887 2627 2 chr6D.!!$F3 1740
12 TraesCS4B01G304000 chr5D 100988722 100990229 1507 False 2529 2529 96.9500 1121 2627 1 chr5D.!!$F1 1506
13 TraesCS4B01G304000 chr4A 716723765 716724600 835 False 1349 1349 95.8180 1 835 1 chr4A.!!$F1 834
14 TraesCS4B01G304000 chr7B 134178086 134178863 777 False 1314 1314 97.1720 1 777 1 chr7B.!!$F1 776
15 TraesCS4B01G304000 chr5B 554278571 554279349 778 False 1310 1310 97.0470 1 777 1 chr5B.!!$F1 776
16 TraesCS4B01G304000 chr6B 694136322 694137099 777 False 1303 1303 96.9150 1 777 1 chr6B.!!$F1 776
17 TraesCS4B01G304000 chr3B 556552400 556553178 778 True 1299 1299 96.7910 1 777 1 chr3B.!!$R1 776
18 TraesCS4B01G304000 chr7D 162134549 162135101 552 False 795 795 92.4030 887 1452 1 chr7D.!!$F1 565

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
947 953 1.183676 ACTCCCAAAGTAGACGCCGT 61.184 55.0 0.0 0.0 36.07 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2367 2702 5.88696 ATAAGAACAGATTTGTCAGGTGC 57.113 39.13 0.0 0.0 36.23 5.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
799 802 9.781633 GTATCTCTACTCCTAATGTCTCAGTTA 57.218 37.037 0.00 0.00 0.00 2.24
841 844 6.406692 TTTATTTTCGTCCCACCATTTTCA 57.593 33.333 0.00 0.00 0.00 2.69
935 941 2.243994 TCTCGATCCCTAGAACTCCCAA 59.756 50.000 0.00 0.00 0.00 4.12
947 953 1.183676 ACTCCCAAAGTAGACGCCGT 61.184 55.000 0.00 0.00 36.07 5.68
1157 1488 2.401766 GGGACGTTCGCCTCTACGA 61.402 63.158 0.00 0.00 40.03 3.43
1242 1573 2.357034 GTCAGCCGCGTTGAGGAA 60.357 61.111 4.92 0.00 0.00 3.36
1323 1654 4.162690 GCGCTCGACTCCCCCATT 62.163 66.667 0.00 0.00 0.00 3.16
1596 1927 0.742990 CCCGGAGCAATAAGTTCGCA 60.743 55.000 0.73 0.00 0.00 5.10
1608 1939 0.679002 AGTTCGCATGCTTCATGGCT 60.679 50.000 17.13 1.32 41.64 4.75
1929 2262 2.919043 GGGGCTGGTATGTCTGGG 59.081 66.667 0.00 0.00 0.00 4.45
2367 2702 4.809426 GGTCATCGTTGGTATCTAAGTTGG 59.191 45.833 0.00 0.00 0.00 3.77
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
140 142 7.795047 ACTCCAAACCTTCAAATGAAATTCTT 58.205 30.769 0.00 0.00 33.67 2.52
348 351 9.311916 GGTGTGAATTAATTTTAATGCATGCTA 57.688 29.630 20.33 5.73 40.00 3.49
903 909 2.124653 ATCGAGAGGAGCGGACGT 60.125 61.111 0.00 0.00 0.00 4.34
935 941 4.125695 GGGCGACGGCGTCTACTT 62.126 66.667 33.90 1.01 42.88 2.24
1224 1555 3.158537 TTCCTCAACGCGGCTGACA 62.159 57.895 12.47 0.00 0.00 3.58
1309 1640 0.176680 CAGACAATGGGGGAGTCGAG 59.823 60.000 0.00 0.00 37.36 4.04
1350 1681 2.981350 GCTTTTTCCCCGCCGACA 60.981 61.111 0.00 0.00 0.00 4.35
1362 1693 2.935955 CAGACGAACGGCGCTTTT 59.064 55.556 6.90 0.00 46.04 2.27
1405 1736 2.020720 CTCCTCGAGCTCATACACACT 58.979 52.381 15.40 0.00 0.00 3.55
1596 1927 3.202548 CTTCCCAGCCATGAAGCAT 57.797 52.632 0.00 0.00 32.37 3.79
1652 1983 4.401202 ACGGTTTAATCATCATTTGGGACC 59.599 41.667 0.00 0.00 0.00 4.46
1929 2262 7.777440 AGAGATGAAATTTATTTCTCTCCCCAC 59.223 37.037 23.20 11.70 44.85 4.61
2367 2702 5.886960 ATAAGAACAGATTTGTCAGGTGC 57.113 39.130 0.00 0.00 36.23 5.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.