Multiple sequence alignment - TraesCS4B01G303800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G303800 chr4B 100.000 1498 0 0 1435 2932 592031412 592029915 0.000000e+00 2767
1 TraesCS4B01G303800 chr4B 98.131 1498 28 0 1435 2932 592155123 592153626 0.000000e+00 2612
2 TraesCS4B01G303800 chr4B 100.000 1129 0 0 1 1129 592032846 592031718 0.000000e+00 2085
3 TraesCS4B01G303800 chr4B 97.522 1130 23 3 1 1129 592156249 592155124 0.000000e+00 1927
4 TraesCS4B01G303800 chr4B 96.392 776 26 2 1 774 107386413 107387188 0.000000e+00 1277
5 TraesCS4B01G303800 chr4B 96.263 776 27 2 1 774 465447235 465446460 0.000000e+00 1271
6 TraesCS4B01G303800 chr4B 91.870 123 4 6 772 890 409002302 409002182 1.810000e-37 167
7 TraesCS4B01G303800 chr3D 97.000 1500 43 1 1435 2932 134599261 134597762 0.000000e+00 2519
8 TraesCS4B01G303800 chr3D 96.798 1499 46 1 1436 2932 365841969 365840471 0.000000e+00 2501
9 TraesCS4B01G303800 chr3D 96.533 1500 50 1 1435 2932 593933878 593935377 0.000000e+00 2481
10 TraesCS4B01G303800 chr3D 96.471 1502 48 4 1435 2932 535654994 535656494 0.000000e+00 2475
11 TraesCS4B01G303800 chr3D 90.251 359 14 6 773 1126 134599598 134599256 1.600000e-122 449
12 TraesCS4B01G303800 chr3D 89.256 363 17 7 767 1123 593933528 593933874 4.490000e-118 435
13 TraesCS4B01G303800 chr5D 96.798 1499 47 1 1435 2932 100988731 100990229 0.000000e+00 2501
14 TraesCS4B01G303800 chr6D 96.667 1500 48 1 1435 2932 466182436 466183935 0.000000e+00 2492
15 TraesCS4B01G303800 chr6D 97.055 1460 41 1 1475 2932 47793110 47794569 0.000000e+00 2457
16 TraesCS4B01G303800 chr6D 94.239 243 10 2 885 1123 47792742 47792984 4.620000e-98 368
17 TraesCS4B01G303800 chr2D 96.203 1501 54 2 1435 2932 472192334 472190834 0.000000e+00 2453
18 TraesCS4B01G303800 chr2D 91.484 364 17 11 765 1126 472192680 472192329 3.400000e-134 488
19 TraesCS4B01G303800 chr7B 96.013 1204 46 2 1435 2638 255251914 255250713 0.000000e+00 1956
20 TraesCS4B01G303800 chr7B 96.645 775 25 1 1 774 134178089 134178863 0.000000e+00 1286
21 TraesCS4B01G303800 chr7B 95.000 360 15 3 772 1129 255252764 255252406 1.970000e-156 562
22 TraesCS4B01G303800 chr4A 95.084 834 38 3 1 832 716723768 716724600 0.000000e+00 1310
23 TraesCS4B01G303800 chr3B 96.521 776 25 2 1 774 556553175 556552400 0.000000e+00 1282
24 TraesCS4B01G303800 chr3B 94.986 359 15 3 772 1129 13052270 13052626 7.100000e-156 560
25 TraesCS4B01G303800 chr3B 97.419 155 1 3 773 926 104276003 104276155 8.060000e-66 261
26 TraesCS4B01G303800 chr6B 96.392 776 26 2 1 774 536671562 536670787 0.000000e+00 1277
27 TraesCS4B01G303800 chr6B 96.387 775 27 1 1 774 694136325 694137099 0.000000e+00 1275
28 TraesCS4B01G303800 chr5B 96.263 776 27 2 1 774 554278574 554279349 0.000000e+00 1271
29 TraesCS4B01G303800 chr7A 91.036 357 18 6 772 1126 597554153 597553809 1.230000e-128 470
30 TraesCS4B01G303800 chr2A 91.197 284 19 5 845 1126 659088670 659088391 5.930000e-102 381
31 TraesCS4B01G303800 chr7D 93.388 242 12 1 885 1126 162134547 162134784 3.590000e-94 355


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G303800 chr4B 592029915 592032846 2931 True 2426.0 2767 100.0000 1 2932 2 chr4B.!!$R3 2931
1 TraesCS4B01G303800 chr4B 592153626 592156249 2623 True 2269.5 2612 97.8265 1 2932 2 chr4B.!!$R4 2931
2 TraesCS4B01G303800 chr4B 107386413 107387188 775 False 1277.0 1277 96.3920 1 774 1 chr4B.!!$F1 773
3 TraesCS4B01G303800 chr4B 465446460 465447235 775 True 1271.0 1271 96.2630 1 774 1 chr4B.!!$R2 773
4 TraesCS4B01G303800 chr3D 365840471 365841969 1498 True 2501.0 2501 96.7980 1436 2932 1 chr3D.!!$R1 1496
5 TraesCS4B01G303800 chr3D 535654994 535656494 1500 False 2475.0 2475 96.4710 1435 2932 1 chr3D.!!$F1 1497
6 TraesCS4B01G303800 chr3D 134597762 134599598 1836 True 1484.0 2519 93.6255 773 2932 2 chr3D.!!$R2 2159
7 TraesCS4B01G303800 chr3D 593933528 593935377 1849 False 1458.0 2481 92.8945 767 2932 2 chr3D.!!$F2 2165
8 TraesCS4B01G303800 chr5D 100988731 100990229 1498 False 2501.0 2501 96.7980 1435 2932 1 chr5D.!!$F1 1497
9 TraesCS4B01G303800 chr6D 466182436 466183935 1499 False 2492.0 2492 96.6670 1435 2932 1 chr6D.!!$F1 1497
10 TraesCS4B01G303800 chr6D 47792742 47794569 1827 False 1412.5 2457 95.6470 885 2932 2 chr6D.!!$F2 2047
11 TraesCS4B01G303800 chr2D 472190834 472192680 1846 True 1470.5 2453 93.8435 765 2932 2 chr2D.!!$R1 2167
12 TraesCS4B01G303800 chr7B 134178089 134178863 774 False 1286.0 1286 96.6450 1 774 1 chr7B.!!$F1 773
13 TraesCS4B01G303800 chr7B 255250713 255252764 2051 True 1259.0 1956 95.5065 772 2638 2 chr7B.!!$R1 1866
14 TraesCS4B01G303800 chr4A 716723768 716724600 832 False 1310.0 1310 95.0840 1 832 1 chr4A.!!$F1 831
15 TraesCS4B01G303800 chr3B 556552400 556553175 775 True 1282.0 1282 96.5210 1 774 1 chr3B.!!$R1 773
16 TraesCS4B01G303800 chr6B 536670787 536671562 775 True 1277.0 1277 96.3920 1 774 1 chr6B.!!$R1 773
17 TraesCS4B01G303800 chr6B 694136325 694137099 774 False 1275.0 1275 96.3870 1 774 1 chr6B.!!$F1 773
18 TraesCS4B01G303800 chr5B 554278574 554279349 775 False 1271.0 1271 96.2630 1 774 1 chr5B.!!$F1 773

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
806 810 0.601558 GTCTCAGTTGGTAGGTCGCA 59.398 55.000 0.0 0.0 0.0 5.10 F
1644 1756 1.077357 ATCGTCTGGCTCGTCTCCT 60.077 57.895 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1856 2456 2.530672 ATACGGCACCCCAACCACA 61.531 57.895 0.0 0.0 0.0 4.17 R
2602 3207 2.780010 CTCATCAGGGAGGTGGGTTAAT 59.220 50.000 0.0 0.0 0.0 1.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
546 550 5.192176 TCATTCTAATAGCATGTTGGCACA 58.808 37.500 0.24 0.0 37.31 4.57
725 729 6.097412 GCTTTTCTCATCCCAATAAGTCCATT 59.903 38.462 0.00 0.0 0.00 3.16
743 747 9.996554 AAGTCCATTGTATATCGTCATTATTGA 57.003 29.630 0.00 0.0 0.00 2.57
806 810 0.601558 GTCTCAGTTGGTAGGTCGCA 59.398 55.000 0.00 0.0 0.00 5.10
1022 1037 1.959985 GGAGATCGAGATCAAGCTCCA 59.040 52.381 17.32 0.0 40.22 3.86
1066 1081 1.380515 CGCCTCTCCTCCTTCCTCA 60.381 63.158 0.00 0.0 0.00 3.86
1493 1605 4.021925 GACCCCTCCTGCGCTGTT 62.022 66.667 9.73 0.0 0.00 3.16
1644 1756 1.077357 ATCGTCTGGCTCGTCTCCT 60.077 57.895 0.00 0.0 0.00 3.69
2060 2660 4.095483 GTGGCGAGTGATTTCAAATCTCAT 59.905 41.667 11.46 0.0 0.00 2.90
2061 2661 4.095334 TGGCGAGTGATTTCAAATCTCATG 59.905 41.667 11.46 5.7 0.00 3.07
2498 3103 1.077068 CCGCCACATGGTTATGGGT 60.077 57.895 0.00 0.0 35.89 4.51
2602 3207 2.093288 CCCTGATGAGCTGCTTCTTGTA 60.093 50.000 2.53 0.0 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 1.656095 CGCTCCTCATTCACGAGAAAC 59.344 52.381 0.00 0.0 37.29 2.78
499 503 6.452757 TTATGATGTGGTATGATGGGATGT 57.547 37.500 0.00 0.0 0.00 3.06
546 550 9.338622 GCTATGAGTTATAATGGTTTACCTTGT 57.661 33.333 0.00 0.0 36.82 3.16
743 747 0.742505 TCGGTCGTGTGAGTGAAAGT 59.257 50.000 0.00 0.0 0.00 2.66
806 810 3.444742 GGGACGAAAATAAAACCCGGAAT 59.555 43.478 0.73 0.0 0.00 3.01
1022 1037 3.842923 CAGCCGCGTCAGGGAGAT 61.843 66.667 4.92 0.0 0.00 2.75
1644 1756 2.717485 GCCGACGCCGTACTCATA 59.283 61.111 0.00 0.0 0.00 2.15
1856 2456 2.530672 ATACGGCACCCCAACCACA 61.531 57.895 0.00 0.0 0.00 4.17
2602 3207 2.780010 CTCATCAGGGAGGTGGGTTAAT 59.220 50.000 0.00 0.0 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.