Multiple sequence alignment - TraesCS4B01G293200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G293200 chr4B 100.000 2429 0 0 1 2429 578516475 578514047 0.000000e+00 4486
1 TraesCS4B01G293200 chr4B 99.177 2429 20 0 1 2429 578382875 578380447 0.000000e+00 4375
2 TraesCS4B01G293200 chr4B 98.971 2429 25 0 1 2429 578507313 578504885 0.000000e+00 4348
3 TraesCS4B01G293200 chr4B 95.945 1603 56 7 1 1598 578463146 578461548 0.000000e+00 2591
4 TraesCS4B01G293200 chr4B 95.758 1603 58 8 1 1598 578374110 578372513 0.000000e+00 2575
5 TraesCS4B01G293200 chr4B 95.571 1603 56 11 1 1598 578498184 578496592 0.000000e+00 2553
6 TraesCS4B01G293200 chr4B 95.321 1603 55 9 1 1598 578452688 578451101 0.000000e+00 2527
7 TraesCS4B01G293200 chr4B 92.676 1775 76 19 697 2429 578532460 578530698 0.000000e+00 2508
8 TraesCS4B01G293200 chr4B 99.153 826 6 1 1604 2429 578459933 578459109 0.000000e+00 1485
9 TraesCS4B01G293200 chr4B 87.775 908 92 10 697 1598 578350307 578349413 0.000000e+00 1044
10 TraesCS4B01G293200 chr4B 87.170 530 59 6 174 701 578669767 578669245 5.780000e-166 593
11 TraesCS4B01G293200 chr4B 88.444 225 16 4 1602 1821 578372478 578372259 1.850000e-66 263
12 TraesCS4B01G293200 chr4B 88.444 225 16 4 1602 1821 578451066 578450847 1.850000e-66 263
13 TraesCS4B01G293200 chr4B 88.444 225 16 4 1602 1821 578461513 578461294 1.850000e-66 263
14 TraesCS4B01G293200 chr4B 88.444 225 16 4 1602 1821 578496557 578496338 1.850000e-66 263
15 TraesCS4B01G293200 chr4D 90.653 1776 107 25 704 2429 462497945 462499711 0.000000e+00 2305
16 TraesCS4B01G293200 chr4A 93.993 899 52 2 697 1595 6476179 6477075 0.000000e+00 1360
17 TraesCS4B01G293200 chr4A 93.660 899 55 2 697 1595 6482212 6483108 0.000000e+00 1343
18 TraesCS4B01G293200 chr4A 94.437 701 33 6 1 699 6478738 6479434 0.000000e+00 1074
19 TraesCS4B01G293200 chr4A 93.599 703 37 6 1 701 6472755 6473451 0.000000e+00 1042
20 TraesCS4B01G293200 chr4A 91.483 317 21 2 2114 2429 6471445 6471756 4.800000e-117 431
21 TraesCS4B01G293200 chr4A 91.167 317 22 2 2114 2429 6448285 6448596 2.230000e-115 425
22 TraesCS4B01G293200 chr4A 89.590 317 26 3 2114 2429 6477429 6477739 1.750000e-106 396
23 TraesCS4B01G293200 chr4A 93.204 206 9 4 1915 2120 6464554 6464754 5.080000e-77 298
24 TraesCS4B01G293200 chr4A 92.233 206 11 4 1915 2120 6439632 6439832 1.100000e-73 287
25 TraesCS4B01G293200 chr4A 96.386 166 5 1 1 166 6449595 6449759 3.080000e-69 272
26 TraesCS4B01G293200 chr4A 95.283 106 1 1 1774 1875 6464188 6464293 5.370000e-37 165
27 TraesCS4B01G293200 chr4A 94.340 106 2 1 1774 1875 6439266 6439371 2.500000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G293200 chr4B 578514047 578516475 2428 True 4486.000000 4486 100.000000 1 2429 1 chr4B.!!$R4 2428
1 TraesCS4B01G293200 chr4B 578380447 578382875 2428 True 4375.000000 4375 99.177000 1 2429 1 chr4B.!!$R2 2428
2 TraesCS4B01G293200 chr4B 578504885 578507313 2428 True 4348.000000 4348 98.971000 1 2429 1 chr4B.!!$R3 2428
3 TraesCS4B01G293200 chr4B 578530698 578532460 1762 True 2508.000000 2508 92.676000 697 2429 1 chr4B.!!$R5 1732
4 TraesCS4B01G293200 chr4B 578459109 578463146 4037 True 1446.333333 2591 94.514000 1 2429 3 chr4B.!!$R9 2428
5 TraesCS4B01G293200 chr4B 578372259 578374110 1851 True 1419.000000 2575 92.101000 1 1821 2 chr4B.!!$R7 1820
6 TraesCS4B01G293200 chr4B 578496338 578498184 1846 True 1408.000000 2553 92.007500 1 1821 2 chr4B.!!$R10 1820
7 TraesCS4B01G293200 chr4B 578450847 578452688 1841 True 1395.000000 2527 91.882500 1 1821 2 chr4B.!!$R8 1820
8 TraesCS4B01G293200 chr4B 578349413 578350307 894 True 1044.000000 1044 87.775000 697 1598 1 chr4B.!!$R1 901
9 TraesCS4B01G293200 chr4B 578669245 578669767 522 True 593.000000 593 87.170000 174 701 1 chr4B.!!$R6 527
10 TraesCS4B01G293200 chr4D 462497945 462499711 1766 False 2305.000000 2305 90.653000 704 2429 1 chr4D.!!$F1 1725
11 TraesCS4B01G293200 chr4A 6471445 6483108 11663 False 941.000000 1360 92.793667 1 2429 6 chr4A.!!$F4 2428
12 TraesCS4B01G293200 chr4A 6448285 6449759 1474 False 348.500000 425 93.776500 1 2429 2 chr4A.!!$F2 2428
13 TraesCS4B01G293200 chr4A 6464188 6464754 566 False 231.500000 298 94.243500 1774 2120 2 chr4A.!!$F3 346
14 TraesCS4B01G293200 chr4A 6439266 6439832 566 False 223.000000 287 93.286500 1774 2120 2 chr4A.!!$F1 346

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
429 1740 4.444591 GGCATCCTGAAAGAGATGATCTGT 60.445 45.833 0.00 0.0 41.31 3.41 F
1088 5151 1.549170 AGCGTACGACCTTTTGGAGAT 59.451 47.619 21.65 0.0 44.07 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1309 5376 0.941542 CGTTGAACCGTGTGGAATGT 59.058 50.000 0.0 0.0 39.21 2.71 R
2360 8279 2.890766 CGCCACCCCACACCTACTT 61.891 63.158 0.0 0.0 0.00 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
382 1693 4.946784 AACTTTCACGGAGATGTTATGC 57.053 40.909 0.00 0.0 0.00 3.14
429 1740 4.444591 GGCATCCTGAAAGAGATGATCTGT 60.445 45.833 0.00 0.0 41.31 3.41
1088 5151 1.549170 AGCGTACGACCTTTTGGAGAT 59.451 47.619 21.65 0.0 44.07 2.75
1309 5376 5.392995 TCCAATTTGAGTGGGATTTTCTCA 58.607 37.500 0.00 0.0 36.73 3.27
1694 5794 6.850555 TCTTGATCTACATAGCATCAGATCG 58.149 40.000 0.00 0.0 44.13 3.69
2329 8247 0.108804 GAGAACGGCCGATTGAGTCA 60.109 55.000 35.90 0.0 0.00 3.41
2337 8255 2.434185 GATTGAGTCACGGCGGCA 60.434 61.111 13.24 0.0 0.00 5.69
2360 8279 2.661537 CGCTGCACAGTCGGTCAA 60.662 61.111 0.00 0.0 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
329 1640 1.951209 TAGCATGAACTCCCAGACCA 58.049 50.000 0.00 0.0 0.00 4.02
382 1693 1.025113 CAGGCCAGCACAGACTCATG 61.025 60.000 5.01 0.0 0.00 3.07
429 1740 9.453572 GCAATAGAATGATTATCTCCCATTGTA 57.546 33.333 0.00 0.0 32.90 2.41
886 4941 1.617850 TGCTGCCCAACGAAATCAAAT 59.382 42.857 0.00 0.0 0.00 2.32
1088 5151 4.382788 CCCGCGGGAAGTTGTTTA 57.617 55.556 41.82 0.0 37.50 2.01
1309 5376 0.941542 CGTTGAACCGTGTGGAATGT 59.058 50.000 0.00 0.0 39.21 2.71
2360 8279 2.890766 CGCCACCCCACACCTACTT 61.891 63.158 0.00 0.0 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.