Multiple sequence alignment - TraesCS4B01G293100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G293100 chr4B 100.000 2429 0 0 1 2429 578507313 578504885 0.000000e+00 4486
1 TraesCS4B01G293100 chr4B 99.300 2429 17 0 1 2429 578382875 578380447 0.000000e+00 4392
2 TraesCS4B01G293100 chr4B 98.971 2429 25 0 1 2429 578516475 578514047 0.000000e+00 4348
3 TraesCS4B01G293100 chr4B 95.930 1597 57 6 1 1592 578463146 578461553 0.000000e+00 2582
4 TraesCS4B01G293100 chr4B 95.742 1597 59 7 1 1592 578374110 578372518 0.000000e+00 2564
5 TraesCS4B01G293100 chr4B 95.617 1597 56 11 1 1592 578498184 578496597 0.000000e+00 2549
6 TraesCS4B01G293100 chr4B 93.070 1775 69 20 697 2429 578532460 578530698 0.000000e+00 2547
7 TraesCS4B01G293100 chr4B 95.304 1597 56 8 1 1592 578452688 578451106 0.000000e+00 2516
8 TraesCS4B01G293100 chr4B 99.393 824 4 1 1606 2429 578459931 578459109 0.000000e+00 1493
9 TraesCS4B01G293100 chr4B 87.845 905 91 10 697 1595 578350307 578349416 0.000000e+00 1044
10 TraesCS4B01G293100 chr4B 87.547 530 57 6 174 701 578669767 578669245 2.670000e-169 604
11 TraesCS4B01G293100 chr4B 89.202 213 13 4 1614 1821 578372466 578372259 8.620000e-65 257
12 TraesCS4B01G293100 chr4B 89.202 213 13 4 1614 1821 578451054 578450847 8.620000e-65 257
13 TraesCS4B01G293100 chr4B 89.202 213 13 4 1614 1821 578461501 578461294 8.620000e-65 257
14 TraesCS4B01G293100 chr4B 89.202 213 13 4 1614 1821 578496545 578496338 8.620000e-65 257
15 TraesCS4B01G293100 chr4D 90.878 1776 103 25 704 2429 462497945 462499711 0.000000e+00 2327
16 TraesCS4B01G293100 chr4A 94.177 893 51 1 697 1589 6476179 6477070 0.000000e+00 1360
17 TraesCS4B01G293100 chr4A 93.841 893 54 1 697 1589 6482212 6483103 0.000000e+00 1343
18 TraesCS4B01G293100 chr4A 94.437 701 33 6 1 699 6478738 6479434 0.000000e+00 1074
19 TraesCS4B01G293100 chr4A 93.599 703 37 6 1 701 6472755 6473451 0.000000e+00 1042
20 TraesCS4B01G293100 chr4A 92.429 317 18 2 2114 2429 6471445 6471756 4.760000e-122 448
21 TraesCS4B01G293100 chr4A 91.483 317 21 2 2114 2429 6448285 6448596 4.800000e-117 431
22 TraesCS4B01G293100 chr4A 89.905 317 25 3 2114 2429 6477429 6477739 3.760000e-108 401
23 TraesCS4B01G293100 chr4A 92.233 206 11 3 1915 2120 6464554 6464754 1.100000e-73 287
24 TraesCS4B01G293100 chr4A 91.262 206 13 4 1915 2120 6439632 6439832 2.380000e-70 276
25 TraesCS4B01G293100 chr4A 95.783 166 6 1 1 166 6449595 6449759 1.430000e-67 267
26 TraesCS4B01G293100 chr4A 95.283 106 1 1 1774 1875 6464188 6464293 5.370000e-37 165
27 TraesCS4B01G293100 chr4A 94.340 106 2 1 1774 1875 6439266 6439371 2.500000e-35 159


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G293100 chr4B 578504885 578507313 2428 True 4486.000000 4486 100.000000 1 2429 1 chr4B.!!$R3 2428
1 TraesCS4B01G293100 chr4B 578380447 578382875 2428 True 4392.000000 4392 99.300000 1 2429 1 chr4B.!!$R2 2428
2 TraesCS4B01G293100 chr4B 578514047 578516475 2428 True 4348.000000 4348 98.971000 1 2429 1 chr4B.!!$R4 2428
3 TraesCS4B01G293100 chr4B 578530698 578532460 1762 True 2547.000000 2547 93.070000 697 2429 1 chr4B.!!$R5 1732
4 TraesCS4B01G293100 chr4B 578459109 578463146 4037 True 1444.000000 2582 94.841667 1 2429 3 chr4B.!!$R9 2428
5 TraesCS4B01G293100 chr4B 578372259 578374110 1851 True 1410.500000 2564 92.472000 1 1821 2 chr4B.!!$R7 1820
6 TraesCS4B01G293100 chr4B 578496338 578498184 1846 True 1403.000000 2549 92.409500 1 1821 2 chr4B.!!$R10 1820
7 TraesCS4B01G293100 chr4B 578450847 578452688 1841 True 1386.500000 2516 92.253000 1 1821 2 chr4B.!!$R8 1820
8 TraesCS4B01G293100 chr4B 578349416 578350307 891 True 1044.000000 1044 87.845000 697 1595 1 chr4B.!!$R1 898
9 TraesCS4B01G293100 chr4B 578669245 578669767 522 True 604.000000 604 87.547000 174 701 1 chr4B.!!$R6 527
10 TraesCS4B01G293100 chr4D 462497945 462499711 1766 False 2327.000000 2327 90.878000 704 2429 1 chr4D.!!$F1 1725
11 TraesCS4B01G293100 chr4A 6471445 6483103 11658 False 944.666667 1360 93.064667 1 2429 6 chr4A.!!$F4 2428
12 TraesCS4B01G293100 chr4A 6448285 6449759 1474 False 349.000000 431 93.633000 1 2429 2 chr4A.!!$F2 2428
13 TraesCS4B01G293100 chr4A 6464188 6464754 566 False 226.000000 287 93.758000 1774 2120 2 chr4A.!!$F3 346
14 TraesCS4B01G293100 chr4A 6439266 6439832 566 False 217.500000 276 92.801000 1774 2120 2 chr4A.!!$F1 346

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
998 5061 3.685139 AAGCAGCAACAGTTAGCTAGA 57.315 42.857 9.15 0.0 39.5 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2100 8006 5.257816 AGGGGAATTACTACTTGGGGATTTT 59.742 40.0 0.0 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 1391 4.577693 CGACAATCTCATCCAATCCAACAT 59.422 41.667 0.00 0.0 0.00 2.71
948 5007 3.702045 GCCTCAGTCTACACATACTTCCT 59.298 47.826 0.00 0.0 0.00 3.36
998 5061 3.685139 AAGCAGCAACAGTTAGCTAGA 57.315 42.857 9.15 0.0 39.50 2.43
1010 5073 0.969149 TAGCTAGACATGGCCATCCG 59.031 55.000 17.61 8.6 32.25 4.18
2141 8047 0.798776 CCTTCAGCAACATGGACGAC 59.201 55.000 0.00 0.0 0.00 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 1391 0.527113 CAAGCCATCGAACATGCCAA 59.473 50.000 0.00 0.0 0.00 4.52
225 1536 2.798976 TTTCCTGTGCAATGCAACTC 57.201 45.000 10.44 0.0 41.47 3.01
829 4884 4.227073 TGATTATCACTCCATCAACCACCA 59.773 41.667 0.00 0.0 0.00 4.17
1010 5073 0.599728 GACGATGAGGAGCAGATGCC 60.600 60.000 0.14 0.0 43.38 4.40
1596 5667 0.474854 TTCCTGTGGTTGGGAGGCTA 60.475 55.000 0.00 0.0 32.80 3.93
1604 5704 4.099266 TGGAATTTCTTGTTCCTGTGGTTG 59.901 41.667 6.47 0.0 44.36 3.77
2100 8006 5.257816 AGGGGAATTACTACTTGGGGATTTT 59.742 40.000 0.00 0.0 0.00 1.82
2141 8047 5.411361 TCCGGATCACAAGAAAATGTTAGTG 59.589 40.000 0.00 0.0 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.