Multiple sequence alignment - TraesCS4B01G293000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G293000 chr4B 100.000 2429 0 0 1 2429 578382875 578380447 0.000000e+00 4486
1 TraesCS4B01G293000 chr4B 99.300 2429 17 0 1 2429 578507313 578504885 0.000000e+00 4392
2 TraesCS4B01G293000 chr4B 99.177 2429 20 0 1 2429 578516475 578514047 0.000000e+00 4375
3 TraesCS4B01G293000 chr4B 96.178 1596 54 5 1 1591 578463146 578461553 0.000000e+00 2603
4 TraesCS4B01G293000 chr4B 95.990 1596 56 6 1 1591 578374110 578372518 0.000000e+00 2586
5 TraesCS4B01G293000 chr4B 95.802 1596 54 9 1 1591 578498184 578496597 0.000000e+00 2564
6 TraesCS4B01G293000 chr4B 93.183 1775 67 16 697 2429 578532460 578530698 0.000000e+00 2558
7 TraesCS4B01G293000 chr4B 95.551 1596 53 7 1 1591 578452688 578451106 0.000000e+00 2538
8 TraesCS4B01G293000 chr4B 99.395 826 4 1 1604 2429 578459933 578459109 0.000000e+00 1496
9 TraesCS4B01G293000 chr4B 88.027 902 90 9 697 1592 578350307 578349418 0.000000e+00 1051
10 TraesCS4B01G293000 chr4B 87.547 530 57 6 174 701 578669767 578669245 2.670000e-169 604
11 TraesCS4B01G293000 chr4D 90.991 1776 101 25 704 2429 462497945 462499711 0.000000e+00 2338
12 TraesCS4B01G293000 chr4D 87.368 95 11 1 1600 1693 462549796 462549890 9.180000e-20 108
13 TraesCS4B01G293000 chr4A 91.214 1104 69 11 697 1774 6476179 6477280 0.000000e+00 1476
14 TraesCS4B01G293000 chr4A 90.851 1104 73 9 697 1774 6482212 6483313 0.000000e+00 1454
15 TraesCS4B01G293000 chr4A 88.247 1038 71 22 694 1689 6460496 6461524 0.000000e+00 1194
16 TraesCS4B01G293000 chr4A 86.893 1030 82 24 697 1689 6435309 6436322 0.000000e+00 1105
17 TraesCS4B01G293000 chr4A 94.579 701 32 6 1 699 6478738 6479434 0.000000e+00 1079
18 TraesCS4B01G293000 chr4A 93.741 703 36 6 1 701 6472755 6473451 0.000000e+00 1048
19 TraesCS4B01G293000 chr4A 86.801 894 103 9 697 1583 6492064 6492949 0.000000e+00 983
20 TraesCS4B01G293000 chr4A 92.429 317 18 2 2114 2429 6471445 6471756 4.760000e-122 448
21 TraesCS4B01G293000 chr4A 92.114 317 19 2 2114 2429 6448285 6448596 2.220000e-120 442
22 TraesCS4B01G293000 chr4A 90.536 317 23 3 2114 2429 6477429 6477739 1.740000e-111 412
23 TraesCS4B01G293000 chr4A 92.233 206 11 4 1915 2120 6464554 6464754 1.100000e-73 287
24 TraesCS4B01G293000 chr4A 91.262 206 13 4 1915 2120 6439632 6439832 2.380000e-70 276
25 TraesCS4B01G293000 chr4A 96.386 166 5 1 1 166 6449595 6449759 3.080000e-69 272
26 TraesCS4B01G293000 chr4A 95.283 106 1 1 1774 1875 6464188 6464293 5.370000e-37 165
27 TraesCS4B01G293000 chr4A 94.340 106 2 1 1774 1875 6439266 6439371 2.500000e-35 159
28 TraesCS4B01G293000 chr4A 93.750 96 4 1 1680 1775 6463933 6464026 2.520000e-30 143
29 TraesCS4B01G293000 chr4A 92.784 97 5 1 1680 1776 6439011 6439105 3.260000e-29 139


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G293000 chr4B 578380447 578382875 2428 True 4486.000000 4486 100.00000 1 2429 1 chr4B.!!$R3 2428
1 TraesCS4B01G293000 chr4B 578504885 578507313 2428 True 4392.000000 4392 99.30000 1 2429 1 chr4B.!!$R6 2428
2 TraesCS4B01G293000 chr4B 578514047 578516475 2428 True 4375.000000 4375 99.17700 1 2429 1 chr4B.!!$R7 2428
3 TraesCS4B01G293000 chr4B 578372518 578374110 1592 True 2586.000000 2586 95.99000 1 1591 1 chr4B.!!$R2 1590
4 TraesCS4B01G293000 chr4B 578496597 578498184 1587 True 2564.000000 2564 95.80200 1 1591 1 chr4B.!!$R5 1590
5 TraesCS4B01G293000 chr4B 578530698 578532460 1762 True 2558.000000 2558 93.18300 697 2429 1 chr4B.!!$R8 1732
6 TraesCS4B01G293000 chr4B 578451106 578452688 1582 True 2538.000000 2538 95.55100 1 1591 1 chr4B.!!$R4 1590
7 TraesCS4B01G293000 chr4B 578459109 578463146 4037 True 2049.500000 2603 97.78650 1 2429 2 chr4B.!!$R10 2428
8 TraesCS4B01G293000 chr4B 578349418 578350307 889 True 1051.000000 1051 88.02700 697 1592 1 chr4B.!!$R1 895
9 TraesCS4B01G293000 chr4B 578669245 578669767 522 True 604.000000 604 87.54700 174 701 1 chr4B.!!$R9 527
10 TraesCS4B01G293000 chr4D 462497945 462499711 1766 False 2338.000000 2338 90.99100 704 2429 1 chr4D.!!$F1 1725
11 TraesCS4B01G293000 chr4A 6471445 6483313 11868 False 986.166667 1476 92.22500 1 2429 6 chr4A.!!$F5 2428
12 TraesCS4B01G293000 chr4A 6492064 6492949 885 False 983.000000 983 86.80100 697 1583 1 chr4A.!!$F1 886
13 TraesCS4B01G293000 chr4A 6460496 6464754 4258 False 447.250000 1194 92.37825 694 2120 4 chr4A.!!$F4 1426
14 TraesCS4B01G293000 chr4A 6435309 6439832 4523 False 419.750000 1105 91.31975 697 2120 4 chr4A.!!$F2 1423
15 TraesCS4B01G293000 chr4A 6448285 6449759 1474 False 357.000000 442 94.25000 1 2429 2 chr4A.!!$F3 2428

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
378 1689 3.186613 GTGGAAACTTTCACGGAGATGTC 59.813 47.826 3.93 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1920 10687 8.939929 TCTGCAAATCAACTAAATAAGAGTCTG 58.06 33.333 0.0 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 1689 3.186613 GTGGAAACTTTCACGGAGATGTC 59.813 47.826 3.93 0.0 0.00 3.06
1862 10408 2.694628 TCATTCCCCATGCATTGTAAGC 59.305 45.455 0.00 0.0 32.13 3.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 1689 1.938577 GCCAGCACAGACTCATACATG 59.061 52.381 0.00 0.0 0.00 3.21
983 5046 2.941415 GCCATGGCTAGCTAACTGTTGT 60.941 50.000 29.98 0.0 38.26 3.32
1862 10408 9.764363 TGTCTAGGCATTTATTAACATGTAGAG 57.236 33.333 0.00 0.0 0.00 2.43
1920 10687 8.939929 TCTGCAAATCAACTAAATAAGAGTCTG 58.060 33.333 0.00 0.0 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.