Multiple sequence alignment - TraesCS4B01G290800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G290800 chr4B 100.000 2677 0 0 1 2677 575741854 575739178 0 4944
1 TraesCS4B01G290800 chr1B 98.506 2678 37 3 1 2677 560196752 560194077 0 4721
2 TraesCS4B01G290800 chr6B 97.946 2678 54 1 1 2677 689046088 689043411 0 4639
3 TraesCS4B01G290800 chr6B 97.535 2678 63 3 1 2677 37740748 37743423 0 4577
4 TraesCS4B01G290800 chr5B 97.946 2678 54 1 1 2677 708895978 708898655 0 4639
5 TraesCS4B01G290800 chr7B 97.797 2678 58 1 1 2677 643684638 643681961 0 4617
6 TraesCS4B01G290800 chr2B 97.797 2678 57 2 1 2677 737145176 737142500 0 4617
7 TraesCS4B01G290800 chr3B 97.699 2694 45 2 1 2677 766116139 766113446 0 4615
8 TraesCS4B01G290800 chr4A 97.685 2678 60 2 1 2677 734638183 734640859 0 4601
9 TraesCS4B01G290800 chr4A 97.610 2678 60 4 1 2677 718582858 718580184 0 4588


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G290800 chr4B 575739178 575741854 2676 True 4944 4944 100.000 1 2677 1 chr4B.!!$R1 2676
1 TraesCS4B01G290800 chr1B 560194077 560196752 2675 True 4721 4721 98.506 1 2677 1 chr1B.!!$R1 2676
2 TraesCS4B01G290800 chr6B 689043411 689046088 2677 True 4639 4639 97.946 1 2677 1 chr6B.!!$R1 2676
3 TraesCS4B01G290800 chr6B 37740748 37743423 2675 False 4577 4577 97.535 1 2677 1 chr6B.!!$F1 2676
4 TraesCS4B01G290800 chr5B 708895978 708898655 2677 False 4639 4639 97.946 1 2677 1 chr5B.!!$F1 2676
5 TraesCS4B01G290800 chr7B 643681961 643684638 2677 True 4617 4617 97.797 1 2677 1 chr7B.!!$R1 2676
6 TraesCS4B01G290800 chr2B 737142500 737145176 2676 True 4617 4617 97.797 1 2677 1 chr2B.!!$R1 2676
7 TraesCS4B01G290800 chr3B 766113446 766116139 2693 True 4615 4615 97.699 1 2677 1 chr3B.!!$R1 2676
8 TraesCS4B01G290800 chr4A 734638183 734640859 2676 False 4601 4601 97.685 1 2677 1 chr4A.!!$F1 2676
9 TraesCS4B01G290800 chr4A 718580184 718582858 2674 True 4588 4588 97.610 1 2677 1 chr4A.!!$R1 2676

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
517 534 0.462225 TTTCCTTTGCACCGTCGACA 60.462 50.0 17.16 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1676 1694 1.317431 TACGCACGTGCTCCCAGTAT 61.317 55.0 35.27 14.09 39.32 2.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
83 84 3.660501 TGCAAGTACGTTCTCTGACAT 57.339 42.857 0.00 0.00 0.00 3.06
491 508 2.282958 TCCTCCTCGCCTGAACGT 60.283 61.111 0.00 0.00 0.00 3.99
508 525 0.526524 CGTGCCGTTTTTCCTTTGCA 60.527 50.000 0.00 0.00 0.00 4.08
517 534 0.462225 TTTCCTTTGCACCGTCGACA 60.462 50.000 17.16 0.00 0.00 4.35
831 848 1.267806 CGAGGCAGCAATGTCAGTTTT 59.732 47.619 0.00 0.00 0.00 2.43
868 885 5.659849 ATAATGGAGAAAAGCCCATCTCT 57.340 39.130 9.33 0.00 41.98 3.10
912 929 8.445275 AGTAATTGACTGTTTGTGTACAATCA 57.555 30.769 0.00 7.91 36.87 2.57
1046 1063 6.469782 AAACCATGAAACTGTTGTCAGAAT 57.530 33.333 0.00 0.00 43.76 2.40
1255 1273 5.381757 CGATAGAAGGGGAGGATATAGAGG 58.618 50.000 0.00 0.00 39.76 3.69
1390 1408 4.455877 GTGATTTCCTGAGACGGTTCATTT 59.544 41.667 0.00 0.00 0.00 2.32
1423 1441 3.064931 GGTACTGTTCTAGCACCAACAC 58.935 50.000 0.00 0.00 41.73 3.32
1434 1452 2.360801 AGCACCAACACCACAACATTAC 59.639 45.455 0.00 0.00 0.00 1.89
1997 2016 1.588404 CGTATCGAGCACCATCACAAC 59.412 52.381 0.00 0.00 0.00 3.32
2015 2034 4.152402 CACAACGACAGCAATTTAGTAGCT 59.848 41.667 0.00 0.00 39.63 3.32
2588 2607 0.617820 TGACAGGAACTCCTAGGGCC 60.618 60.000 9.46 0.00 46.65 5.80
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
83 84 2.403378 GCAAGCCCGGAAATGCGTA 61.403 57.895 0.73 0.00 0.00 4.42
427 444 1.450312 CCCTCAGATCACGTTGGCC 60.450 63.158 0.00 0.00 0.00 5.36
491 508 0.179097 GGTGCAAAGGAAAAACGGCA 60.179 50.000 0.00 0.00 0.00 5.69
508 525 1.354506 GTATAGCGCTGTCGACGGT 59.645 57.895 24.68 14.37 44.44 4.83
1046 1063 9.952030 TTCTGATATGATGTACTTTTTGTGGTA 57.048 29.630 0.00 0.00 0.00 3.25
1255 1273 3.057596 TCGGTTTGATTTTCCAGATGTGC 60.058 43.478 0.00 0.00 0.00 4.57
1390 1408 4.382291 AGAACAGTACCAATTGCGTACAA 58.618 39.130 25.76 3.28 38.85 2.41
1434 1452 3.797256 GGTTGAGATATTTCGAGTCCACG 59.203 47.826 0.00 0.00 0.00 4.94
1676 1694 1.317431 TACGCACGTGCTCCCAGTAT 61.317 55.000 35.27 14.09 39.32 2.12
1997 2016 4.112634 TGCTAGCTACTAAATTGCTGTCG 58.887 43.478 17.23 0.00 39.89 4.35
2015 2034 4.344102 AGTCTTTGGAGTACACACTTGCTA 59.656 41.667 0.00 0.00 34.21 3.49
2380 2399 9.317936 TGTAACAATGCAAACAATAATGAACAA 57.682 25.926 0.00 0.00 0.00 2.83
2588 2607 1.669115 CCCTGTCGTGACTTGGCTG 60.669 63.158 1.23 0.00 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.