Multiple sequence alignment - TraesCS4B01G289900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G289900 chr4B 100.000 2448 0 0 1 2448 574590069 574592516 0 4521
1 TraesCS4B01G289900 chr4B 97.431 2452 58 5 1 2448 57126069 57123619 0 4174
2 TraesCS4B01G289900 chr6B 97.633 2450 56 2 1 2448 663151557 663149108 0 4202
3 TraesCS4B01G289900 chr5B 97.551 2450 58 2 1 2448 41406866 41404417 0 4191
4 TraesCS4B01G289900 chr5B 97.510 2450 58 3 1 2448 494655854 494658302 0 4183
5 TraesCS4B01G289900 chr5B 97.348 2451 61 4 1 2448 660354746 660352297 0 4163
6 TraesCS4B01G289900 chr5B 97.185 2451 63 6 1 2448 494664109 494661662 0 4139
7 TraesCS4B01G289900 chr2B 97.429 2450 61 2 1 2448 50469409 50471858 0 4174
8 TraesCS4B01G289900 chr1B 96.774 2449 75 3 1 2448 654687358 654684913 0 4082
9 TraesCS4B01G289900 chr4A 96.367 2450 75 7 1 2448 661072729 661070292 0 4019


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G289900 chr4B 574590069 574592516 2447 False 4521 4521 100.000 1 2448 1 chr4B.!!$F1 2447
1 TraesCS4B01G289900 chr4B 57123619 57126069 2450 True 4174 4174 97.431 1 2448 1 chr4B.!!$R1 2447
2 TraesCS4B01G289900 chr6B 663149108 663151557 2449 True 4202 4202 97.633 1 2448 1 chr6B.!!$R1 2447
3 TraesCS4B01G289900 chr5B 41404417 41406866 2449 True 4191 4191 97.551 1 2448 1 chr5B.!!$R1 2447
4 TraesCS4B01G289900 chr5B 494655854 494658302 2448 False 4183 4183 97.510 1 2448 1 chr5B.!!$F1 2447
5 TraesCS4B01G289900 chr5B 660352297 660354746 2449 True 4163 4163 97.348 1 2448 1 chr5B.!!$R3 2447
6 TraesCS4B01G289900 chr5B 494661662 494664109 2447 True 4139 4139 97.185 1 2448 1 chr5B.!!$R2 2447
7 TraesCS4B01G289900 chr2B 50469409 50471858 2449 False 4174 4174 97.429 1 2448 1 chr2B.!!$F1 2447
8 TraesCS4B01G289900 chr1B 654684913 654687358 2445 True 4082 4082 96.774 1 2448 1 chr1B.!!$R1 2447
9 TraesCS4B01G289900 chr4A 661070292 661072729 2437 True 4019 4019 96.367 1 2448 1 chr4A.!!$R1 2447

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
419 421 0.036732 GATCAAGTCCAGCACCACCA 59.963 55.0 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2090 2097 0.739813 GCACTTGGTAGCCTGGTACG 60.74 60.0 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 119 1.229209 TTCTCCTGTTCCCCGAGCT 60.229 57.895 0.0 0.00 0.00 4.09
228 229 1.194781 GGCCTCACTCCTCCTTGACA 61.195 60.000 0.0 0.00 0.00 3.58
257 259 1.490574 AATCCACTTCTCCTCCTCGG 58.509 55.000 0.0 0.00 0.00 4.63
388 390 2.000447 GAATGCCTTCGCTACTTCGTT 59.000 47.619 0.0 0.00 35.36 3.85
416 418 0.247460 CGAGATCAAGTCCAGCACCA 59.753 55.000 0.0 0.00 0.00 4.17
419 421 0.036732 GATCAAGTCCAGCACCACCA 59.963 55.000 0.0 0.00 0.00 4.17
623 625 1.523711 CGTCCGCCATAGCCATTGT 60.524 57.895 0.0 0.00 34.57 2.71
689 691 1.447217 CTCCTATGCACGCCCATGA 59.553 57.895 0.0 0.00 0.00 3.07
877 879 3.877357 CGCTCGCTCCGTCTGCTA 61.877 66.667 0.0 0.00 0.00 3.49
947 949 1.267574 CCCTCAGCCTTGCCTACTGA 61.268 60.000 0.0 0.00 38.09 3.41
989 991 2.283604 TGCTCTACCGCTGGGACA 60.284 61.111 0.0 0.00 36.97 4.02
1099 1101 2.039624 GAGGCAGGAGGTCTGGGA 59.960 66.667 0.0 0.00 43.54 4.37
1100 1102 1.383803 GAGGCAGGAGGTCTGGGAT 60.384 63.158 0.0 0.00 43.54 3.85
1657 1662 9.487790 GACAAATTGAACCAATAAAAGGAATCA 57.512 29.630 0.0 0.00 32.43 2.57
1964 1970 9.492973 AGACAAATTGAACCAATAAAAGGAATG 57.507 29.630 0.0 0.00 32.43 2.67
2355 2362 5.312895 TCCTTTCATCATTGAAACTTCGGA 58.687 37.500 0.0 1.25 44.81 4.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
118 119 2.479198 CGTCTCAGTAGCGACGCA 59.521 61.111 23.70 5.17 44.61 5.24
157 158 1.559219 TCCATTCTCCTTCGATGCCAA 59.441 47.619 0.00 0.00 0.00 4.52
228 229 0.704664 GAAGTGGATTTGGGAGGGGT 59.295 55.000 0.00 0.00 0.00 4.95
281 283 2.338620 CCGTGGCGTCTGACTTCA 59.661 61.111 6.21 1.31 0.00 3.02
339 341 4.148825 ACAAGCTCCTAGCCCGCG 62.149 66.667 0.00 0.00 43.77 6.46
388 390 0.602638 ACTTGATCTCGTTGGCGCAA 60.603 50.000 10.83 0.00 38.14 4.85
623 625 2.443390 GCTCGGTGGCTACCCCTA 60.443 66.667 14.41 0.00 44.53 3.53
818 820 3.454587 GACCAGGGTGTGTGTCGCA 62.455 63.158 0.00 0.00 0.00 5.10
938 940 1.270839 GGAAGCAACACTCAGTAGGCA 60.271 52.381 0.00 0.00 34.22 4.75
1099 1101 2.130193 ACCATAGCCAGGTGACATCAT 58.870 47.619 0.00 0.00 38.13 2.45
1100 1102 1.583556 ACCATAGCCAGGTGACATCA 58.416 50.000 0.00 0.00 38.13 3.07
1539 1544 8.452534 TGCAAATCAATTGATTCCTTTTATTGC 58.547 29.630 29.08 28.20 43.41 3.56
1964 1970 9.822185 ACTTCCTTAAATTATGCAAATCAATCC 57.178 29.630 0.00 0.00 0.00 3.01
2090 2097 0.739813 GCACTTGGTAGCCTGGTACG 60.740 60.000 0.00 0.00 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.