Multiple sequence alignment - TraesCS4B01G282700
BLAST Results
Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.
qseqid | sseqid | percentage.identical | alignment.length | no.mismatch | no.gap.openings | qstart | qend | sstart | send | evalue | bitscore | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
0 | TraesCS4B01G282700 | chr4B | 100.000 | 4298 | 0 | 0 | 1 | 4298 | 565986200 | 565990497 | 0.000000e+00 | 7938.0 |
1 | TraesCS4B01G282700 | chr4B | 100.000 | 4102 | 0 | 0 | 4614 | 8715 | 565990813 | 565994914 | 0.000000e+00 | 7576.0 |
2 | TraesCS4B01G282700 | chr4B | 94.453 | 631 | 35 | 0 | 8085 | 8715 | 566007062 | 566007692 | 0.000000e+00 | 972.0 |
3 | TraesCS4B01G282700 | chr4B | 90.205 | 633 | 59 | 3 | 8085 | 8715 | 452655906 | 452656537 | 0.000000e+00 | 822.0 |
4 | TraesCS4B01G282700 | chr4B | 75.970 | 1082 | 174 | 45 | 2796 | 3829 | 377372662 | 377371619 | 6.120000e-131 | 479.0 |
5 | TraesCS4B01G282700 | chr4B | 74.416 | 813 | 160 | 27 | 3198 | 3976 | 380691686 | 380690888 | 1.100000e-78 | 305.0 |
6 | TraesCS4B01G282700 | chr4B | 76.560 | 593 | 83 | 33 | 3 | 557 | 611410373 | 611409799 | 3.100000e-69 | 274.0 |
7 | TraesCS4B01G282700 | chr4B | 77.755 | 481 | 83 | 15 | 2713 | 3186 | 643760099 | 643760562 | 3.100000e-69 | 274.0 |
8 | TraesCS4B01G282700 | chr4B | 78.174 | 449 | 66 | 19 | 129 | 557 | 629379750 | 629379314 | 3.120000e-64 | 257.0 |
9 | TraesCS4B01G282700 | chr4B | 78.519 | 270 | 56 | 2 | 2879 | 3147 | 18141545 | 18141277 | 8.990000e-40 | 176.0 |
10 | TraesCS4B01G282700 | chr4B | 94.681 | 94 | 5 | 0 | 5458 | 5551 | 565991565 | 565991658 | 7.050000e-31 | 147.0 |
11 | TraesCS4B01G282700 | chr4B | 94.681 | 94 | 5 | 0 | 5366 | 5459 | 565991657 | 565991750 | 7.050000e-31 | 147.0 |
12 | TraesCS4B01G282700 | chr4B | 78.788 | 99 | 15 | 5 | 2661 | 2754 | 489433566 | 489433469 | 2.630000e-05 | 62.1 |
13 | TraesCS4B01G282700 | chr4B | 100.000 | 28 | 0 | 0 | 429 | 456 | 629379662 | 629379689 | 1.600000e-02 | 52.8 |
14 | TraesCS4B01G282700 | chr4D | 90.556 | 2033 | 114 | 29 | 5567 | 7577 | 452808440 | 452810416 | 0.000000e+00 | 2619.0 |
15 | TraesCS4B01G282700 | chr4D | 93.263 | 1232 | 55 | 7 | 712 | 1915 | 452803316 | 452804547 | 0.000000e+00 | 1790.0 |
16 | TraesCS4B01G282700 | chr4D | 76.436 | 1549 | 287 | 49 | 2578 | 4058 | 499732129 | 499730591 | 0.000000e+00 | 767.0 |
17 | TraesCS4B01G282700 | chr4D | 82.240 | 732 | 88 | 20 | 4747 | 5445 | 452807573 | 452808295 | 2.090000e-165 | 593.0 |
18 | TraesCS4B01G282700 | chr4D | 93.137 | 306 | 20 | 1 | 2107 | 2411 | 27567424 | 27567119 | 1.730000e-121 | 448.0 |
19 | TraesCS4B01G282700 | chr4D | 94.326 | 282 | 16 | 0 | 7579 | 7860 | 442392821 | 442392540 | 4.830000e-117 | 433.0 |
20 | TraesCS4B01G282700 | chr4D | 77.372 | 685 | 122 | 23 | 3243 | 3901 | 9477368 | 9476691 | 8.260000e-100 | 375.0 |
21 | TraesCS4B01G282700 | chr4D | 78.207 | 569 | 92 | 21 | 2876 | 3417 | 497254351 | 497254914 | 1.400000e-87 | 335.0 |
22 | TraesCS4B01G282700 | chr4D | 87.681 | 138 | 9 | 7 | 1945 | 2075 | 452806821 | 452806957 | 4.210000e-33 | 154.0 |
23 | TraesCS4B01G282700 | chr4D | 96.591 | 88 | 3 | 0 | 7957 | 8044 | 452850227 | 452850314 | 7.050000e-31 | 147.0 |
24 | TraesCS4B01G282700 | chr4D | 95.122 | 41 | 2 | 0 | 2414 | 2454 | 454415150 | 454415110 | 2.030000e-06 | 65.8 |
25 | TraesCS4B01G282700 | chr4A | 96.516 | 1550 | 47 | 6 | 6034 | 7577 | 14182517 | 14180969 | 0.000000e+00 | 2556.0 |
26 | TraesCS4B01G282700 | chr4A | 94.141 | 990 | 44 | 7 | 986 | 1961 | 14185448 | 14184459 | 0.000000e+00 | 1495.0 |
27 | TraesCS4B01G282700 | chr4A | 86.971 | 591 | 39 | 17 | 1 | 557 | 710818018 | 710818604 | 1.600000e-176 | 630.0 |
28 | TraesCS4B01G282700 | chr4A | 76.812 | 897 | 151 | 27 | 2572 | 3431 | 34304987 | 34305863 | 1.330000e-122 | 451.0 |
29 | TraesCS4B01G282700 | chr4A | 89.062 | 320 | 29 | 4 | 673 | 986 | 14185800 | 14185481 | 8.200000e-105 | 392.0 |
30 | TraesCS4B01G282700 | chr4A | 84.211 | 95 | 6 | 5 | 558 | 651 | 14187471 | 14187385 | 5.610000e-12 | 84.2 |
31 | TraesCS4B01G282700 | chr7B | 92.429 | 634 | 44 | 3 | 8085 | 8715 | 338196634 | 338196002 | 0.000000e+00 | 902.0 |
32 | TraesCS4B01G282700 | chr7B | 92.089 | 632 | 49 | 1 | 8085 | 8715 | 338183896 | 338183265 | 0.000000e+00 | 889.0 |
33 | TraesCS4B01G282700 | chr7B | 86.444 | 568 | 44 | 11 | 1 | 557 | 161241572 | 161241027 | 7.530000e-165 | 592.0 |
34 | TraesCS4B01G282700 | chr7B | 94.667 | 300 | 15 | 1 | 2111 | 2409 | 395605299 | 395605000 | 1.710000e-126 | 464.0 |
35 | TraesCS4B01G282700 | chr7B | 94.932 | 296 | 14 | 1 | 2111 | 2405 | 74202718 | 74203013 | 6.160000e-126 | 462.0 |
36 | TraesCS4B01G282700 | chr7B | 94.000 | 300 | 15 | 3 | 2108 | 2406 | 605960583 | 605960880 | 1.330000e-122 | 451.0 |
37 | TraesCS4B01G282700 | chr7B | 77.016 | 496 | 84 | 17 | 3246 | 3726 | 222703724 | 222703244 | 3.120000e-64 | 257.0 |
38 | TraesCS4B01G282700 | chr7B | 92.683 | 41 | 3 | 0 | 2072 | 2112 | 649987168 | 649987128 | 9.450000e-05 | 60.2 |
39 | TraesCS4B01G282700 | chr2B | 91.125 | 631 | 55 | 1 | 8085 | 8715 | 681284234 | 681284863 | 0.000000e+00 | 854.0 |
40 | TraesCS4B01G282700 | chr2B | 75.659 | 1442 | 227 | 55 | 2551 | 3927 | 478186164 | 478187546 | 9.680000e-169 | 604.0 |
41 | TraesCS4B01G282700 | chr2B | 85.473 | 592 | 45 | 20 | 1 | 557 | 444551439 | 444550854 | 5.870000e-161 | 579.0 |
42 | TraesCS4B01G282700 | chr2B | 83.648 | 159 | 18 | 6 | 404 | 557 | 798654700 | 798654545 | 9.120000e-30 | 143.0 |
43 | TraesCS4B01G282700 | chr2B | 82.222 | 90 | 12 | 3 | 2371 | 2457 | 2853852 | 2853764 | 3.370000e-09 | 75.0 |
44 | TraesCS4B01G282700 | chr2B | 82.222 | 90 | 12 | 3 | 2371 | 2457 | 204508738 | 204508650 | 3.370000e-09 | 75.0 |
45 | TraesCS4B01G282700 | chr2B | 88.679 | 53 | 6 | 0 | 2405 | 2457 | 644171870 | 644171922 | 2.030000e-06 | 65.8 |
46 | TraesCS4B01G282700 | chr2B | 88.000 | 50 | 6 | 0 | 2402 | 2451 | 599908848 | 599908799 | 9.450000e-05 | 60.2 |
47 | TraesCS4B01G282700 | chr2B | 96.970 | 33 | 0 | 1 | 2080 | 2112 | 148143881 | 148143850 | 4.000000e-03 | 54.7 |
48 | TraesCS4B01G282700 | chr6B | 90.679 | 633 | 57 | 2 | 8085 | 8715 | 140842015 | 140841383 | 0.000000e+00 | 841.0 |
49 | TraesCS4B01G282700 | chr6B | 90.236 | 635 | 56 | 6 | 8085 | 8715 | 140829129 | 140828497 | 0.000000e+00 | 824.0 |
50 | TraesCS4B01G282700 | chr6B | 88.756 | 587 | 33 | 8 | 1 | 557 | 476551 | 475968 | 0.000000e+00 | 688.0 |
51 | TraesCS4B01G282700 | chr6B | 80.055 | 361 | 54 | 8 | 212 | 557 | 207774057 | 207773700 | 1.450000e-62 | 252.0 |
52 | TraesCS4B01G282700 | chr6B | 75.624 | 521 | 93 | 16 | 3264 | 3753 | 412111178 | 412110661 | 2.450000e-55 | 228.0 |
53 | TraesCS4B01G282700 | chr6B | 83.544 | 158 | 21 | 3 | 404 | 557 | 170994470 | 170994314 | 9.120000e-30 | 143.0 |
54 | TraesCS4B01G282700 | chr1B | 90.665 | 632 | 58 | 1 | 8085 | 8715 | 544974523 | 544973892 | 0.000000e+00 | 839.0 |
55 | TraesCS4B01G282700 | chr1B | 90.032 | 632 | 61 | 2 | 8085 | 8715 | 544960007 | 544959377 | 0.000000e+00 | 817.0 |
56 | TraesCS4B01G282700 | chr1B | 94.932 | 296 | 14 | 1 | 2111 | 2405 | 4647381 | 4647086 | 6.160000e-126 | 462.0 |
57 | TraesCS4B01G282700 | chr1B | 90.411 | 73 | 6 | 1 | 3790 | 3862 | 290526127 | 290526198 | 2.590000e-15 | 95.3 |
58 | TraesCS4B01G282700 | chr1B | 97.561 | 41 | 1 | 0 | 2072 | 2112 | 637475914 | 637475954 | 4.360000e-08 | 71.3 |
59 | TraesCS4B01G282700 | chr7A | 75.720 | 1528 | 263 | 53 | 2572 | 4015 | 508569059 | 508567556 | 0.000000e+00 | 667.0 |
60 | TraesCS4B01G282700 | chr7A | 92.905 | 296 | 20 | 1 | 7568 | 7862 | 458978873 | 458978578 | 6.250000e-116 | 429.0 |
61 | TraesCS4B01G282700 | chr7A | 91.111 | 45 | 2 | 2 | 2661 | 2704 | 541877094 | 541877137 | 9.450000e-05 | 60.2 |
62 | TraesCS4B01G282700 | chr3B | 87.500 | 592 | 37 | 19 | 1 | 558 | 617687508 | 617688096 | 0.000000e+00 | 649.0 |
63 | TraesCS4B01G282700 | chr3B | 94.595 | 296 | 15 | 1 | 2111 | 2405 | 783126776 | 783126481 | 2.870000e-124 | 457.0 |
64 | TraesCS4B01G282700 | chr3B | 84.393 | 173 | 26 | 1 | 2711 | 2882 | 684622103 | 684622275 | 1.500000e-37 | 169.0 |
65 | TraesCS4B01G282700 | chr5D | 85.500 | 600 | 40 | 22 | 1 | 557 | 385126193 | 385126788 | 4.530000e-162 | 582.0 |
66 | TraesCS4B01G282700 | chr5D | 85.429 | 501 | 51 | 11 | 72 | 557 | 460675647 | 460676140 | 1.310000e-137 | 501.0 |
67 | TraesCS4B01G282700 | chr5D | 93.448 | 290 | 19 | 0 | 7573 | 7862 | 72764099 | 72764388 | 1.740000e-116 | 431.0 |
68 | TraesCS4B01G282700 | chr5D | 81.373 | 306 | 53 | 4 | 2816 | 3119 | 227731876 | 227732179 | 6.760000e-61 | 246.0 |
69 | TraesCS4B01G282700 | chr5D | 76.113 | 494 | 79 | 17 | 3220 | 3676 | 416589927 | 416590418 | 1.140000e-53 | 222.0 |
70 | TraesCS4B01G282700 | chr5D | 75.735 | 408 | 76 | 13 | 3491 | 3879 | 388738083 | 388737680 | 5.370000e-42 | 183.0 |
71 | TraesCS4B01G282700 | chr5D | 81.319 | 91 | 15 | 2 | 3968 | 4057 | 385692533 | 385692444 | 1.210000e-08 | 73.1 |
72 | TraesCS4B01G282700 | chr6D | 85.333 | 600 | 42 | 20 | 1 | 558 | 78029655 | 78029060 | 5.870000e-161 | 579.0 |
73 | TraesCS4B01G282700 | chr6D | 77.409 | 602 | 91 | 26 | 3187 | 3755 | 435010483 | 435011072 | 5.080000e-82 | 316.0 |
74 | TraesCS4B01G282700 | chr5B | 96.119 | 335 | 12 | 1 | 1 | 335 | 613181260 | 613180927 | 5.950000e-151 | 545.0 |
75 | TraesCS4B01G282700 | chr5B | 80.731 | 602 | 108 | 8 | 2600 | 3198 | 246591450 | 246590854 | 6.160000e-126 | 462.0 |
76 | TraesCS4B01G282700 | chr5B | 92.880 | 309 | 20 | 2 | 2099 | 2405 | 382259068 | 382259376 | 1.730000e-121 | 448.0 |
77 | TraesCS4B01G282700 | chr5B | 73.817 | 634 | 130 | 24 | 3451 | 4058 | 21366598 | 21367221 | 1.470000e-52 | 219.0 |
78 | TraesCS4B01G282700 | chr5B | 72.337 | 676 | 138 | 26 | 3444 | 4082 | 636543089 | 636542426 | 5.410000e-37 | 167.0 |
79 | TraesCS4B01G282700 | chr5B | 93.023 | 43 | 3 | 0 | 2408 | 2450 | 665899394 | 665899436 | 7.300000e-06 | 63.9 |
80 | TraesCS4B01G282700 | chr3A | 86.561 | 506 | 45 | 17 | 69 | 557 | 27234865 | 27234366 | 3.580000e-148 | 536.0 |
81 | TraesCS4B01G282700 | chr3A | 92.333 | 300 | 20 | 1 | 7563 | 7862 | 390010366 | 390010662 | 2.910000e-114 | 424.0 |
82 | TraesCS4B01G282700 | chr3A | 80.126 | 317 | 52 | 10 | 2792 | 3101 | 681644878 | 681645190 | 8.800000e-55 | 226.0 |
83 | TraesCS4B01G282700 | chr3A | 90.411 | 73 | 6 | 1 | 3790 | 3862 | 162667026 | 162666955 | 2.590000e-15 | 95.3 |
84 | TraesCS4B01G282700 | chr7D | 83.986 | 562 | 76 | 13 | 2566 | 3122 | 4784183 | 4783631 | 2.150000e-145 | 527.0 |
85 | TraesCS4B01G282700 | chr7D | 80.128 | 624 | 100 | 9 | 2578 | 3183 | 4736650 | 4736033 | 2.230000e-120 | 444.0 |
86 | TraesCS4B01G282700 | chr7D | 75.292 | 599 | 110 | 18 | 3187 | 3753 | 384987559 | 384988151 | 1.450000e-62 | 252.0 |
87 | TraesCS4B01G282700 | chr7D | 76.447 | 501 | 86 | 12 | 3246 | 3726 | 246527621 | 246527133 | 8.740000e-60 | 243.0 |
88 | TraesCS4B01G282700 | chr2D | 93.645 | 299 | 18 | 1 | 2108 | 2405 | 518263573 | 518263871 | 6.210000e-121 | 446.0 |
89 | TraesCS4B01G282700 | chr2D | 76.111 | 900 | 159 | 28 | 3221 | 4074 | 19591655 | 19590766 | 3.760000e-113 | 420.0 |
90 | TraesCS4B01G282700 | chr2D | 82.271 | 361 | 34 | 14 | 1 | 332 | 144555095 | 144554736 | 1.430000e-72 | 285.0 |
91 | TraesCS4B01G282700 | chr2D | 78.862 | 246 | 45 | 6 | 2878 | 3119 | 201822417 | 201822659 | 9.060000e-35 | 159.0 |
92 | TraesCS4B01G282700 | chr2D | 84.314 | 153 | 16 | 6 | 411 | 557 | 622292230 | 622292380 | 9.120000e-30 | 143.0 |
93 | TraesCS4B01G282700 | chr3D | 93.069 | 303 | 20 | 1 | 2104 | 2405 | 572420609 | 572420911 | 8.030000e-120 | 442.0 |
94 | TraesCS4B01G282700 | chr3D | 83.544 | 158 | 25 | 1 | 2875 | 3031 | 537113550 | 537113707 | 7.050000e-31 | 147.0 |
95 | TraesCS4B01G282700 | chr3D | 90.411 | 73 | 6 | 1 | 3790 | 3862 | 154160394 | 154160465 | 2.590000e-15 | 95.3 |
96 | TraesCS4B01G282700 | chr3D | 89.286 | 56 | 4 | 2 | 2414 | 2468 | 75958836 | 75958890 | 1.570000e-07 | 69.4 |
97 | TraesCS4B01G282700 | chr3D | 95.122 | 41 | 2 | 0 | 2414 | 2454 | 403817495 | 403817455 | 2.030000e-06 | 65.8 |
98 | TraesCS4B01G282700 | chr3D | 88.889 | 45 | 4 | 1 | 3079 | 3122 | 172782766 | 172782722 | 4.000000e-03 | 54.7 |
99 | TraesCS4B01G282700 | chr2A | 94.118 | 289 | 17 | 0 | 7579 | 7867 | 623148062 | 623147774 | 2.890000e-119 | 440.0 |
100 | TraesCS4B01G282700 | chr2A | 94.386 | 285 | 15 | 1 | 7576 | 7860 | 387541365 | 387541648 | 3.740000e-118 | 436.0 |
101 | TraesCS4B01G282700 | chr2A | 73.631 | 895 | 172 | 34 | 3187 | 4025 | 621441002 | 621440116 | 3.980000e-73 | 287.0 |
102 | TraesCS4B01G282700 | chr2A | 76.894 | 528 | 93 | 17 | 3262 | 3778 | 54853649 | 54853140 | 1.110000e-68 | 272.0 |
103 | TraesCS4B01G282700 | chr2A | 78.189 | 243 | 41 | 10 | 6176 | 6412 | 34119066 | 34118830 | 2.540000e-30 | 145.0 |
104 | TraesCS4B01G282700 | chr2A | 95.238 | 42 | 2 | 0 | 2676 | 2717 | 429723403 | 429723444 | 5.650000e-07 | 67.6 |
105 | TraesCS4B01G282700 | chr2A | 89.091 | 55 | 5 | 1 | 2404 | 2458 | 724498048 | 724498101 | 5.650000e-07 | 67.6 |
106 | TraesCS4B01G282700 | chr5A | 93.836 | 292 | 16 | 2 | 7572 | 7862 | 141109095 | 141108805 | 1.040000e-118 | 438.0 |
107 | TraesCS4B01G282700 | chr5A | 92.157 | 306 | 19 | 5 | 7562 | 7862 | 488597092 | 488596787 | 2.250000e-115 | 427.0 |
108 | TraesCS4B01G282700 | chr5A | 72.123 | 1399 | 281 | 70 | 2710 | 4055 | 568684907 | 568683565 | 1.090000e-83 | 322.0 |
109 | TraesCS4B01G282700 | chr5A | 78.800 | 500 | 76 | 12 | 2565 | 3040 | 68290615 | 68290122 | 8.500000e-80 | 309.0 |
110 | TraesCS4B01G282700 | chr5A | 74.390 | 656 | 113 | 35 | 3258 | 3879 | 540287635 | 540287001 | 6.810000e-56 | 230.0 |
111 | TraesCS4B01G282700 | chr5A | 73.428 | 636 | 130 | 24 | 3274 | 3879 | 22612250 | 22612876 | 1.480000e-47 | 202.0 |
112 | TraesCS4B01G282700 | chr5A | 73.651 | 482 | 86 | 21 | 3484 | 3946 | 693304267 | 693304726 | 1.960000e-31 | 148.0 |
113 | TraesCS4B01G282700 | chr1A | 93.793 | 290 | 18 | 0 | 7573 | 7862 | 27754265 | 27754554 | 3.740000e-118 | 436.0 |
114 | TraesCS4B01G282700 | chr1A | 74.672 | 916 | 182 | 24 | 3187 | 4058 | 487460166 | 487461075 | 2.310000e-95 | 361.0 |
115 | TraesCS4B01G282700 | chr1A | 100.000 | 29 | 0 | 0 | 2068 | 2096 | 516728827 | 516728855 | 4.000000e-03 | 54.7 |
116 | TraesCS4B01G282700 | chr1D | 81.049 | 591 | 71 | 18 | 1 | 557 | 379575465 | 379574882 | 4.830000e-117 | 433.0 |
117 | TraesCS4B01G282700 | chr1D | 80.000 | 300 | 54 | 6 | 2875 | 3171 | 387891402 | 387891698 | 5.300000e-52 | 217.0 |
118 | TraesCS4B01G282700 | chr1D | 80.682 | 176 | 30 | 2 | 2711 | 2882 | 387891198 | 387891373 | 5.490000e-27 | 134.0 |
119 | TraesCS4B01G282700 | chr6A | 77.886 | 511 | 93 | 14 | 3484 | 3980 | 591214375 | 591214879 | 5.110000e-77 | 300.0 |
These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.
query | scaffold | start | end | length | rev.comp | avg.bitscore | max.bitscore | avg.percent.identical | query.start | query.end | num_hsp | groupid | homo_length | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0 | TraesCS4B01G282700 | chr4B | 565986200 | 565994914 | 8714 | False | 3952.0 | 7938 | 97.3405 | 1 | 8715 | 4 | chr4B.!!$F5 | 8714 |
1 | TraesCS4B01G282700 | chr4B | 566007062 | 566007692 | 630 | False | 972.0 | 972 | 94.4530 | 8085 | 8715 | 1 | chr4B.!!$F2 | 630 |
2 | TraesCS4B01G282700 | chr4B | 452655906 | 452656537 | 631 | False | 822.0 | 822 | 90.2050 | 8085 | 8715 | 1 | chr4B.!!$F1 | 630 |
3 | TraesCS4B01G282700 | chr4B | 377371619 | 377372662 | 1043 | True | 479.0 | 479 | 75.9700 | 2796 | 3829 | 1 | chr4B.!!$R2 | 1033 |
4 | TraesCS4B01G282700 | chr4B | 380690888 | 380691686 | 798 | True | 305.0 | 305 | 74.4160 | 3198 | 3976 | 1 | chr4B.!!$R3 | 778 |
5 | TraesCS4B01G282700 | chr4B | 611409799 | 611410373 | 574 | True | 274.0 | 274 | 76.5600 | 3 | 557 | 1 | chr4B.!!$R5 | 554 |
6 | TraesCS4B01G282700 | chr4D | 452803316 | 452810416 | 7100 | False | 1289.0 | 2619 | 88.4350 | 712 | 7577 | 4 | chr4D.!!$F3 | 6865 |
7 | TraesCS4B01G282700 | chr4D | 499730591 | 499732129 | 1538 | True | 767.0 | 767 | 76.4360 | 2578 | 4058 | 1 | chr4D.!!$R5 | 1480 |
8 | TraesCS4B01G282700 | chr4D | 9476691 | 9477368 | 677 | True | 375.0 | 375 | 77.3720 | 3243 | 3901 | 1 | chr4D.!!$R1 | 658 |
9 | TraesCS4B01G282700 | chr4D | 497254351 | 497254914 | 563 | False | 335.0 | 335 | 78.2070 | 2876 | 3417 | 1 | chr4D.!!$F2 | 541 |
10 | TraesCS4B01G282700 | chr4A | 14180969 | 14187471 | 6502 | True | 1131.8 | 2556 | 90.9825 | 558 | 7577 | 4 | chr4A.!!$R1 | 7019 |
11 | TraesCS4B01G282700 | chr4A | 710818018 | 710818604 | 586 | False | 630.0 | 630 | 86.9710 | 1 | 557 | 1 | chr4A.!!$F2 | 556 |
12 | TraesCS4B01G282700 | chr4A | 34304987 | 34305863 | 876 | False | 451.0 | 451 | 76.8120 | 2572 | 3431 | 1 | chr4A.!!$F1 | 859 |
13 | TraesCS4B01G282700 | chr7B | 338196002 | 338196634 | 632 | True | 902.0 | 902 | 92.4290 | 8085 | 8715 | 1 | chr7B.!!$R4 | 630 |
14 | TraesCS4B01G282700 | chr7B | 338183265 | 338183896 | 631 | True | 889.0 | 889 | 92.0890 | 8085 | 8715 | 1 | chr7B.!!$R3 | 630 |
15 | TraesCS4B01G282700 | chr7B | 161241027 | 161241572 | 545 | True | 592.0 | 592 | 86.4440 | 1 | 557 | 1 | chr7B.!!$R1 | 556 |
16 | TraesCS4B01G282700 | chr2B | 681284234 | 681284863 | 629 | False | 854.0 | 854 | 91.1250 | 8085 | 8715 | 1 | chr2B.!!$F3 | 630 |
17 | TraesCS4B01G282700 | chr2B | 478186164 | 478187546 | 1382 | False | 604.0 | 604 | 75.6590 | 2551 | 3927 | 1 | chr2B.!!$F1 | 1376 |
18 | TraesCS4B01G282700 | chr2B | 444550854 | 444551439 | 585 | True | 579.0 | 579 | 85.4730 | 1 | 557 | 1 | chr2B.!!$R4 | 556 |
19 | TraesCS4B01G282700 | chr6B | 140841383 | 140842015 | 632 | True | 841.0 | 841 | 90.6790 | 8085 | 8715 | 1 | chr6B.!!$R3 | 630 |
20 | TraesCS4B01G282700 | chr6B | 140828497 | 140829129 | 632 | True | 824.0 | 824 | 90.2360 | 8085 | 8715 | 1 | chr6B.!!$R2 | 630 |
21 | TraesCS4B01G282700 | chr6B | 475968 | 476551 | 583 | True | 688.0 | 688 | 88.7560 | 1 | 557 | 1 | chr6B.!!$R1 | 556 |
22 | TraesCS4B01G282700 | chr6B | 412110661 | 412111178 | 517 | True | 228.0 | 228 | 75.6240 | 3264 | 3753 | 1 | chr6B.!!$R6 | 489 |
23 | TraesCS4B01G282700 | chr1B | 544973892 | 544974523 | 631 | True | 839.0 | 839 | 90.6650 | 8085 | 8715 | 1 | chr1B.!!$R3 | 630 |
24 | TraesCS4B01G282700 | chr1B | 544959377 | 544960007 | 630 | True | 817.0 | 817 | 90.0320 | 8085 | 8715 | 1 | chr1B.!!$R2 | 630 |
25 | TraesCS4B01G282700 | chr7A | 508567556 | 508569059 | 1503 | True | 667.0 | 667 | 75.7200 | 2572 | 4015 | 1 | chr7A.!!$R2 | 1443 |
26 | TraesCS4B01G282700 | chr3B | 617687508 | 617688096 | 588 | False | 649.0 | 649 | 87.5000 | 1 | 558 | 1 | chr3B.!!$F1 | 557 |
27 | TraesCS4B01G282700 | chr5D | 385126193 | 385126788 | 595 | False | 582.0 | 582 | 85.5000 | 1 | 557 | 1 | chr5D.!!$F3 | 556 |
28 | TraesCS4B01G282700 | chr6D | 78029060 | 78029655 | 595 | True | 579.0 | 579 | 85.3330 | 1 | 558 | 1 | chr6D.!!$R1 | 557 |
29 | TraesCS4B01G282700 | chr6D | 435010483 | 435011072 | 589 | False | 316.0 | 316 | 77.4090 | 3187 | 3755 | 1 | chr6D.!!$F1 | 568 |
30 | TraesCS4B01G282700 | chr5B | 246590854 | 246591450 | 596 | True | 462.0 | 462 | 80.7310 | 2600 | 3198 | 1 | chr5B.!!$R1 | 598 |
31 | TraesCS4B01G282700 | chr5B | 21366598 | 21367221 | 623 | False | 219.0 | 219 | 73.8170 | 3451 | 4058 | 1 | chr5B.!!$F1 | 607 |
32 | TraesCS4B01G282700 | chr7D | 4783631 | 4784183 | 552 | True | 527.0 | 527 | 83.9860 | 2566 | 3122 | 1 | chr7D.!!$R2 | 556 |
33 | TraesCS4B01G282700 | chr7D | 4736033 | 4736650 | 617 | True | 444.0 | 444 | 80.1280 | 2578 | 3183 | 1 | chr7D.!!$R1 | 605 |
34 | TraesCS4B01G282700 | chr7D | 384987559 | 384988151 | 592 | False | 252.0 | 252 | 75.2920 | 3187 | 3753 | 1 | chr7D.!!$F1 | 566 |
35 | TraesCS4B01G282700 | chr2D | 19590766 | 19591655 | 889 | True | 420.0 | 420 | 76.1110 | 3221 | 4074 | 1 | chr2D.!!$R1 | 853 |
36 | TraesCS4B01G282700 | chr2A | 621440116 | 621441002 | 886 | True | 287.0 | 287 | 73.6310 | 3187 | 4025 | 1 | chr2A.!!$R3 | 838 |
37 | TraesCS4B01G282700 | chr2A | 54853140 | 54853649 | 509 | True | 272.0 | 272 | 76.8940 | 3262 | 3778 | 1 | chr2A.!!$R2 | 516 |
38 | TraesCS4B01G282700 | chr5A | 568683565 | 568684907 | 1342 | True | 322.0 | 322 | 72.1230 | 2710 | 4055 | 1 | chr5A.!!$R5 | 1345 |
39 | TraesCS4B01G282700 | chr5A | 540287001 | 540287635 | 634 | True | 230.0 | 230 | 74.3900 | 3258 | 3879 | 1 | chr5A.!!$R4 | 621 |
40 | TraesCS4B01G282700 | chr5A | 22612250 | 22612876 | 626 | False | 202.0 | 202 | 73.4280 | 3274 | 3879 | 1 | chr5A.!!$F1 | 605 |
41 | TraesCS4B01G282700 | chr1A | 487460166 | 487461075 | 909 | False | 361.0 | 361 | 74.6720 | 3187 | 4058 | 1 | chr1A.!!$F2 | 871 |
42 | TraesCS4B01G282700 | chr1D | 379574882 | 379575465 | 583 | True | 433.0 | 433 | 81.0490 | 1 | 557 | 1 | chr1D.!!$R1 | 556 |
43 | TraesCS4B01G282700 | chr6A | 591214375 | 591214879 | 504 | False | 300.0 | 300 | 77.8860 | 3484 | 3980 | 1 | chr6A.!!$F1 | 496 |
AutoCloner calculated primer pairsThese primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible. |
---|
Position | MSA Position | Penalty | Sequence | TM | GC | Self any TH | Self end TH | Hairpin | End Stability | Orientation |
---|---|---|---|---|---|---|---|---|---|---|
997 | 2667 | 0.036010 | ACAGCGACCCTTCATCCAAG | 60.036 | 55.000 | 0.00 | 0.00 | 0.00 | 3.61 | F |
1740 | 3413 | 1.078637 | GGACTACCGGGCAGGAAAC | 60.079 | 63.158 | 11.67 | 0.00 | 45.00 | 2.78 | F |
2380 | 6396 | 0.094730 | GGTGCGCAACGTAAGATGAC | 59.905 | 55.000 | 14.00 | 0.00 | 43.67 | 3.06 | F |
3547 | 8528 | 0.038892 | GCGTCAGTCGTCCCAAAGTA | 60.039 | 55.000 | 0.00 | 0.00 | 42.13 | 2.24 | F |
4086 | 9191 | 0.173481 | CGGACATCGCGATCCCATAT | 59.827 | 55.000 | 26.96 | 9.25 | 0.00 | 1.78 | F |
4639 | 9744 | 0.038343 | CTTTGGGCATGAACGGTTGG | 60.038 | 55.000 | 0.00 | 0.00 | 0.00 | 3.77 | F |
4682 | 9787 | 0.110486 | GAACAGGGCTGAGGTTTGGA | 59.890 | 55.000 | 0.00 | 0.00 | 0.00 | 3.53 | F |
4683 | 9788 | 0.111253 | AACAGGGCTGAGGTTTGGAG | 59.889 | 55.000 | 0.00 | 0.00 | 0.00 | 3.86 | F |
5210 | 10322 | 0.116342 | TCTAGGCCCCTGTCTCAACA | 59.884 | 55.000 | 0.00 | 0.00 | 0.00 | 3.33 | F |
5619 | 10872 | 0.179062 | ATCGCTGGAGATGAAGCCAC | 60.179 | 55.000 | 0.00 | 0.00 | 35.98 | 5.01 | F |
5629 | 10882 | 0.606401 | ATGAAGCCACGGACAACCAG | 60.606 | 55.000 | 0.00 | 0.00 | 35.59 | 4.00 | F |
7250 | 12582 | 0.105658 | CGAGAGGGACAGGGGGATAA | 60.106 | 60.000 | 0.00 | 0.00 | 0.00 | 1.75 | F |
Position | MSA Position | Penalty | Sequence | TM | GC | Self any TH | Self end TH | Hairpin | End Stability | Orientation |
---|---|---|---|---|---|---|---|---|---|---|
2162 | 6178 | 0.033781 | TGTACCGCGCCTAAGTGTTT | 59.966 | 50.000 | 0.00 | 0.00 | 0.00 | 2.83 | R |
3196 | 7551 | 0.037734 | TGCTCGACTCCTACCACTCA | 59.962 | 55.000 | 0.00 | 0.00 | 0.00 | 3.41 | R |
3718 | 8757 | 0.242825 | GACCGTTCGTCTGTCCATCA | 59.757 | 55.000 | 0.00 | 0.00 | 38.57 | 3.07 | R |
4620 | 9725 | 0.038343 | CCAACCGTTCATGCCCAAAG | 60.038 | 55.000 | 0.00 | 0.00 | 0.00 | 2.77 | R |
5446 | 10584 | 0.179032 | TGGCCAGTGTTGTTGTCGAT | 60.179 | 50.000 | 0.00 | 0.00 | 0.00 | 3.59 | R |
5667 | 10922 | 0.250513 | GAACCGCAGATCTTGTCCCT | 59.749 | 55.000 | 0.00 | 0.00 | 0.00 | 4.20 | R |
6310 | 11608 | 0.659957 | CGTAGTAGCCGTCCAGGTAC | 59.340 | 60.000 | 0.00 | 0.00 | 43.70 | 3.34 | R |
6492 | 11791 | 2.609984 | CCGTGATCTGCATCAGAGGATC | 60.610 | 54.545 | 6.07 | 5.46 | 44.08 | 3.36 | R |
6748 | 12080 | 0.031314 | CGTCCTCCATGATCTGGTCG | 59.969 | 60.000 | 9.98 | 0.00 | 46.08 | 4.79 | R |
6793 | 12125 | 1.750399 | GTGGTAGACGGCGAGGGTA | 60.750 | 63.158 | 16.62 | 0.00 | 0.00 | 3.69 | R |
7617 | 12953 | 2.492881 | GGTGTTGATTGATGACATGGCA | 59.507 | 45.455 | 2.18 | 2.18 | 0.00 | 4.92 | R |
8198 | 13534 | 0.251209 | TAGTCGGCCTGTGAGACAGT | 60.251 | 55.000 | 0.00 | 0.00 | 44.50 | 3.55 | R |
All possible primersListed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives. |
---|

Based at the University of Bristol with support from BBSRC.
AutoCloner maintained by Alex Coulton.