Multiple sequence alignment - TraesCS4B01G273900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G273900 chr4B 100.000 2288 0 0 1 2288 551784715 551787002 0.000000e+00 4226
1 TraesCS4B01G273900 chr4B 97.728 2289 51 1 1 2288 551730107 551732395 0.000000e+00 3938
2 TraesCS4B01G273900 chr7B 93.735 1724 98 7 2 1724 150842115 150843829 0.000000e+00 2577
3 TraesCS4B01G273900 chr7B 89.415 359 38 0 1723 2081 141013494 141013136 9.640000e-124 453
4 TraesCS4B01G273900 chr7D 93.616 1723 108 2 2 1723 463975826 463974105 0.000000e+00 2571
5 TraesCS4B01G273900 chr7D 93.326 1723 110 2 2 1719 107722767 107721045 0.000000e+00 2540
6 TraesCS4B01G273900 chr6D 93.666 1721 102 6 4 1723 450905965 450907679 0.000000e+00 2567
7 TraesCS4B01G273900 chr2B 92.812 1725 115 6 2 1723 459481020 459479302 0.000000e+00 2490
8 TraesCS4B01G273900 chr2B 88.301 359 41 1 1723 2081 154531251 154530894 1.620000e-116 429
9 TraesCS4B01G273900 chr5B 92.063 1726 124 5 2 1723 641300599 641298883 0.000000e+00 2416
10 TraesCS4B01G273900 chr5B 88.889 189 21 0 1893 2081 41260465 41260277 1.370000e-57 233
11 TraesCS4B01G273900 chr5B 90.551 127 12 0 1723 1849 592834328 592834202 3.910000e-38 169
12 TraesCS4B01G273900 chr3A 92.032 1732 119 14 2 1725 418765656 418763936 0.000000e+00 2416
13 TraesCS4B01G273900 chr6B 92.058 1725 120 8 2 1721 189103565 189105277 0.000000e+00 2410
14 TraesCS4B01G273900 chr4D 95.265 359 17 0 1723 2081 442882788 442882430 9.170000e-159 569
15 TraesCS4B01G273900 chr4D 94.986 359 18 0 1723 2081 442878644 442879002 4.270000e-157 564
16 TraesCS4B01G273900 chr4D 96.682 211 6 1 2079 2288 442879049 442879259 1.300000e-92 350
17 TraesCS4B01G273900 chr4D 95.673 208 8 1 2082 2288 442882380 442882173 1.310000e-87 333
18 TraesCS4B01G273900 chr4A 94.429 359 20 0 1723 2081 24812148 24811790 9.240000e-154 553
19 TraesCS4B01G273900 chr4A 90.556 360 33 1 1723 2081 656482781 656482422 2.060000e-130 475
20 TraesCS4B01G273900 chr4A 93.396 212 9 2 2082 2288 24811740 24811529 2.210000e-80 309
21 TraesCS4B01G273900 chr5A 90.808 359 33 0 1723 2081 689900346 689900704 4.420000e-132 481


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G273900 chr4B 551784715 551787002 2287 False 4226 4226 100.0000 1 2288 1 chr4B.!!$F2 2287
1 TraesCS4B01G273900 chr4B 551730107 551732395 2288 False 3938 3938 97.7280 1 2288 1 chr4B.!!$F1 2287
2 TraesCS4B01G273900 chr7B 150842115 150843829 1714 False 2577 2577 93.7350 2 1724 1 chr7B.!!$F1 1722
3 TraesCS4B01G273900 chr7D 463974105 463975826 1721 True 2571 2571 93.6160 2 1723 1 chr7D.!!$R2 1721
4 TraesCS4B01G273900 chr7D 107721045 107722767 1722 True 2540 2540 93.3260 2 1719 1 chr7D.!!$R1 1717
5 TraesCS4B01G273900 chr6D 450905965 450907679 1714 False 2567 2567 93.6660 4 1723 1 chr6D.!!$F1 1719
6 TraesCS4B01G273900 chr2B 459479302 459481020 1718 True 2490 2490 92.8120 2 1723 1 chr2B.!!$R2 1721
7 TraesCS4B01G273900 chr5B 641298883 641300599 1716 True 2416 2416 92.0630 2 1723 1 chr5B.!!$R3 1721
8 TraesCS4B01G273900 chr3A 418763936 418765656 1720 True 2416 2416 92.0320 2 1725 1 chr3A.!!$R1 1723
9 TraesCS4B01G273900 chr6B 189103565 189105277 1712 False 2410 2410 92.0580 2 1721 1 chr6B.!!$F1 1719
10 TraesCS4B01G273900 chr4D 442878644 442879259 615 False 457 564 95.8340 1723 2288 2 chr4D.!!$F1 565
11 TraesCS4B01G273900 chr4D 442882173 442882788 615 True 451 569 95.4690 1723 2288 2 chr4D.!!$R1 565
12 TraesCS4B01G273900 chr4A 24811529 24812148 619 True 431 553 93.9125 1723 2288 2 chr4A.!!$R2 565

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
765 770 0.622136 AGAGCAATGAGATGGGCACA 59.378 50.0 0.0 0.0 0.0 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1963 1988 2.670905 CGAAACTGCGGAACATATCACA 59.329 45.455 0.0 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 1.009829 ATCTTCTTGTTCATCGCCGC 58.990 50.000 0.00 0.0 0.00 6.53
182 186 2.047274 CACCAATGACCGTCGGCT 60.047 61.111 12.28 0.0 0.00 5.52
273 277 5.780282 TGGATCACTTCTTCCTCTGTTTAGA 59.220 40.000 0.00 0.0 32.95 2.10
765 770 0.622136 AGAGCAATGAGATGGGCACA 59.378 50.000 0.00 0.0 0.00 4.57
1163 1174 2.474359 CCGTTCATCAGATCAAGATCGC 59.526 50.000 4.54 0.0 42.48 4.58
1253 1264 0.596600 GAGGTCGTCAACAAGTGCGA 60.597 55.000 0.00 0.0 34.73 5.10
1884 1909 4.339247 CCACCAATCTGAAACTCAGTTTGT 59.661 41.667 7.75 0.0 45.65 2.83
1891 1916 6.222038 TCTGAAACTCAGTTTGTAGAGTGT 57.778 37.500 7.75 0.0 43.88 3.55
1963 1988 2.242572 CGCATAGCAGCATCGCAGT 61.243 57.895 0.00 0.0 0.00 4.40
2008 2033 0.107993 CCTGATCACACAGCCGACAT 60.108 55.000 0.00 0.0 36.67 3.06
2140 2218 1.144936 GCAGAGCAGGCCGAGTATT 59.855 57.895 0.00 0.0 0.00 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 1.063811 GCCGTCGTACCTAGCAGAC 59.936 63.158 0.00 0.00 0.00 3.51
909 918 2.356553 TCGTAGTTGCGGCGCTTT 60.357 55.556 33.26 19.58 0.00 3.51
1042 1052 3.620488 TGTTGTTCCTGAGCTTGAACTT 58.380 40.909 19.17 0.00 41.10 2.66
1163 1174 1.732259 GCTTGAACGTCACCATGTAGG 59.268 52.381 0.00 0.00 45.67 3.18
1253 1264 1.731720 GAAGGCTTCGTCATGCTTCT 58.268 50.000 12.12 0.00 0.00 2.85
1647 1671 3.117776 TCAGCCTGACTATCCAAATGCAT 60.118 43.478 0.00 0.00 0.00 3.96
1891 1916 4.039488 AGTGACAGGATTTACAACGTGGTA 59.961 41.667 0.00 0.00 0.00 3.25
1963 1988 2.670905 CGAAACTGCGGAACATATCACA 59.329 45.455 0.00 0.00 0.00 3.58
2140 2218 4.744137 CGAAAATGTCACTGCAAATGGAAA 59.256 37.500 0.00 0.00 0.00 3.13


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.