Multiple sequence alignment - TraesCS4B01G256700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G256700 chr4B 100.000 1588 0 0 677 2264 522404479 522406066 0.000000e+00 2933.0
1 TraesCS4B01G256700 chr4B 100.000 416 0 0 1 416 522403803 522404218 0.000000e+00 769.0
2 TraesCS4B01G256700 chr5B 96.156 1587 35 7 681 2264 123787653 123789216 0.000000e+00 2569.0
3 TraesCS4B01G256700 chr5B 97.693 1127 26 0 681 1807 514051342 514052468 0.000000e+00 1938.0
4 TraesCS4B01G256700 chr5B 97.415 1083 27 1 678 1759 18184790 18185872 0.000000e+00 1844.0
5 TraesCS4B01G256700 chr5B 97.320 1082 26 2 681 1759 353930053 353928972 0.000000e+00 1834.0
6 TraesCS4B01G256700 chr5B 98.317 416 7 0 1 416 123787216 123787631 0.000000e+00 730.0
7 TraesCS4B01G256700 chr5B 97.596 416 10 0 1 416 353930493 353930078 0.000000e+00 713.0
8 TraesCS4B01G256700 chr5B 97.561 410 10 0 7 416 18184359 18184768 0.000000e+00 702.0
9 TraesCS4B01G256700 chr5B 94.885 391 15 4 1755 2143 18185796 18186183 6.920000e-170 606.0
10 TraesCS4B01G256700 chr5B 94.629 391 16 4 1755 2143 353929048 353928661 3.220000e-168 601.0
11 TraesCS4B01G256700 chr5B 84.804 612 53 27 1674 2263 514052370 514052963 1.510000e-161 579.0
12 TraesCS4B01G256700 chr5B 88.021 192 21 2 1932 2122 514052738 514052928 2.260000e-55 226.0
13 TraesCS4B01G256700 chr5B 86.631 187 23 2 1936 2122 123788996 123789180 2.950000e-49 206.0
14 TraesCS4B01G256700 chr5B 85.938 192 25 2 2037 2227 514052633 514052823 1.060000e-48 204.0
15 TraesCS4B01G256700 chr5B 90.678 118 11 0 2147 2264 18186151 18186268 8.370000e-35 158.0
16 TraesCS4B01G256700 chr5B 90.435 115 11 0 2150 2264 353928690 353928576 3.890000e-33 152.0
17 TraesCS4B01G256700 chr5B 89.535 86 7 2 2143 2227 514052633 514052717 8.550000e-20 108.0
18 TraesCS4B01G256700 chr7B 94.619 1468 40 20 678 2143 666616521 666617951 0.000000e+00 2237.0
19 TraesCS4B01G256700 chr7B 96.563 1251 23 2 681 1931 535436471 535435241 0.000000e+00 2054.0
20 TraesCS4B01G256700 chr7B 98.558 416 6 0 1 416 666616084 666616499 0.000000e+00 736.0
21 TraesCS4B01G256700 chr7B 98.317 416 7 0 1 416 664951228 664950813 0.000000e+00 730.0
22 TraesCS4B01G256700 chr7B 98.077 416 8 0 1 416 535436908 535436493 0.000000e+00 725.0
23 TraesCS4B01G256700 chr7B 90.678 118 11 0 2147 2264 666617919 666618036 8.370000e-35 158.0
24 TraesCS4B01G256700 chr3B 97.685 1080 24 1 681 1759 734226683 734225604 0.000000e+00 1855.0
25 TraesCS4B01G256700 chr3B 97.837 416 9 0 1 416 734227123 734226708 0.000000e+00 719.0
26 TraesCS4B01G256700 chr3B 95.141 391 14 4 1755 2143 734225680 734225293 1.490000e-171 612.0
27 TraesCS4B01G256700 chr3B 91.304 115 10 0 2150 2264 734225322 734225208 8.370000e-35 158.0
28 TraesCS4B01G256700 chr4A 97.342 1091 25 2 690 1777 692376407 692375318 0.000000e+00 1851.0
29 TraesCS4B01G256700 chr4A 97.356 416 11 0 1 416 692376811 692376396 0.000000e+00 708.0
30 TraesCS4B01G256700 chr4A 90.671 343 27 3 1925 2264 692375205 692374865 3.430000e-123 451.0
31 TraesCS4B01G256700 chr6B 95.675 1133 44 2 681 1810 77327511 77326381 0.000000e+00 1816.0
32 TraesCS4B01G256700 chr6B 98.077 52 1 0 1830 1881 77326381 77326330 8.610000e-15 91.6
33 TraesCS4B01G256700 chr1B 98.317 416 7 0 1 416 643572045 643572460 0.000000e+00 730.0
34 TraesCS4B01G256700 chr3D 80.220 182 18 15 1709 1881 581474306 581474478 1.100000e-23 121.0
35 TraesCS4B01G256700 chr2D 80.347 173 17 15 1718 1881 126688077 126687913 5.110000e-22 115.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G256700 chr4B 522403803 522406066 2263 False 1851.000000 2933 100.000000 1 2264 2 chr4B.!!$F1 2263
1 TraesCS4B01G256700 chr5B 123787216 123789216 2000 False 1168.333333 2569 93.701333 1 2264 3 chr5B.!!$F2 2263
2 TraesCS4B01G256700 chr5B 18184359 18186268 1909 False 827.500000 1844 95.134750 7 2264 4 chr5B.!!$F1 2257
3 TraesCS4B01G256700 chr5B 353928576 353930493 1917 True 825.000000 1834 94.995000 1 2264 4 chr5B.!!$R1 2263
4 TraesCS4B01G256700 chr5B 514051342 514052963 1621 False 611.000000 1938 89.198200 681 2263 5 chr5B.!!$F3 1582
5 TraesCS4B01G256700 chr7B 535435241 535436908 1667 True 1389.500000 2054 97.320000 1 1931 2 chr7B.!!$R2 1930
6 TraesCS4B01G256700 chr7B 666616084 666618036 1952 False 1043.666667 2237 94.618333 1 2264 3 chr7B.!!$F1 2263
7 TraesCS4B01G256700 chr3B 734225208 734227123 1915 True 836.000000 1855 95.491750 1 2264 4 chr3B.!!$R1 2263
8 TraesCS4B01G256700 chr4A 692374865 692376811 1946 True 1003.333333 1851 95.123000 1 2264 3 chr4A.!!$R1 2263
9 TraesCS4B01G256700 chr6B 77326330 77327511 1181 True 953.800000 1816 96.876000 681 1881 2 chr6B.!!$R1 1200

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
766 767 0.677842 GACAACGTGGTAGAGGTGGT 59.322 55.0 0.0 0.0 28.71 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1621 1624 2.147958 GTCTTTATTGGGTCACACGCA 58.852 47.619 0.0 0.0 39.39 5.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 1.225745 GCGGCGTCGTCAAGAAATG 60.226 57.895 12.58 0.00 38.89 2.32
218 219 5.339530 CCCAAGGGTAGAATCAGACAGAAAT 60.340 44.000 0.00 0.00 0.00 2.17
766 767 0.677842 GACAACGTGGTAGAGGTGGT 59.322 55.000 0.00 0.00 28.71 4.16
1007 1010 3.939740 TCTTCTCATAGGCATGGCTTT 57.060 42.857 28.30 17.19 32.61 3.51
1391 1394 2.079925 GAAGTGCCAGAAGATGTCCAC 58.920 52.381 0.00 0.00 32.37 4.02
1620 1623 1.886655 GCGACAAGAAGGGGAAATGGT 60.887 52.381 0.00 0.00 0.00 3.55
1621 1624 2.514803 CGACAAGAAGGGGAAATGGTT 58.485 47.619 0.00 0.00 0.00 3.67
1792 1836 8.451908 AACCTAAGTTATGCTATTTGATGGAC 57.548 34.615 0.00 0.00 33.27 4.02
1810 1854 7.497595 TGATGGACACTATGTAATGAACCTAC 58.502 38.462 0.00 0.00 0.00 3.18
2159 2397 2.922503 TCTGCCCAGACGCCAGAA 60.923 61.111 0.00 0.00 31.41 3.02
2188 2426 4.386711 GCGTTTAGGCCCTATACAGAAAT 58.613 43.478 11.26 0.00 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 1.374252 ATTTCTTGACGACGCCGCT 60.374 52.632 0.00 0.0 39.95 5.52
35 36 3.610040 TGTCCCATCAGACACATGTAC 57.390 47.619 0.00 0.0 41.78 2.90
218 219 1.412710 GTCCATATCGCCTCTCAACCA 59.587 52.381 0.00 0.0 0.00 3.67
682 683 3.455469 CTACGACCACCGGACCCC 61.455 72.222 9.46 0.0 43.93 4.95
683 684 2.361610 TCTACGACCACCGGACCC 60.362 66.667 9.46 0.0 43.93 4.46
684 685 2.413142 CCTCTACGACCACCGGACC 61.413 68.421 9.46 0.0 43.93 4.46
685 686 1.676967 ACCTCTACGACCACCGGAC 60.677 63.158 9.46 0.0 43.93 4.79
766 767 1.722034 CTCTAGGGCCTCCATTAGCA 58.278 55.000 10.74 0.0 34.83 3.49
1007 1010 1.378882 CCTCGTCGTGGAACCGGATA 61.379 60.000 9.46 0.0 0.00 2.59
1391 1394 4.038402 AGGCAATCTTGAAGTTGGTCTTTG 59.962 41.667 8.72 0.0 36.40 2.77
1621 1624 2.147958 GTCTTTATTGGGTCACACGCA 58.852 47.619 0.00 0.0 39.39 5.24
1792 1836 7.652105 AGCATAACGTAGGTTCATTACATAGTG 59.348 37.037 3.67 0.0 37.58 2.74
1810 1854 6.377327 AAGTTCCCATCAAATAGCATAACG 57.623 37.500 0.00 0.0 0.00 3.18
2072 2275 6.520231 AACCACAGAATTACCTCTCTGGTTAC 60.520 42.308 10.44 0.0 46.69 2.50
2159 2397 2.670592 GGCCTAAACGCCGTGGTT 60.671 61.111 0.00 0.0 39.64 3.67
2181 2419 4.615912 GCAACCGCAGATTTACATTTCTGT 60.616 41.667 2.30 0.0 41.16 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.