Multiple sequence alignment - TraesCS4B01G252800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G252800 chr4B 100.000 2441 0 0 1 2441 518681729 518684169 0.000000e+00 4508.0
1 TraesCS4B01G252800 chr1B 99.263 2443 16 2 1 2441 119686323 119683881 0.000000e+00 4410.0
2 TraesCS4B01G252800 chr1B 87.671 73 5 2 890 962 159410843 159410775 5.590000e-12 82.4
3 TraesCS4B01G252800 chr6B 97.790 2443 51 3 1 2441 159424964 159422523 0.000000e+00 4209.0
4 TraesCS4B01G252800 chr6B 85.714 784 49 22 138 860 345157554 345158335 0.000000e+00 769.0
5 TraesCS4B01G252800 chr1A 97.708 2443 51 3 1 2441 350406998 350404559 0.000000e+00 4196.0
6 TraesCS4B01G252800 chr6D 94.306 2441 103 5 1 2407 69019447 69021885 0.000000e+00 3705.0
7 TraesCS4B01G252800 chr5B 93.092 1549 97 6 861 2407 698068987 698067447 0.000000e+00 2259.0
8 TraesCS4B01G252800 chr5B 89.495 495 28 3 212 683 698105600 698105107 2.680000e-169 604.0
9 TraesCS4B01G252800 chr5B 87.972 424 20 4 138 530 629356333 629356756 2.840000e-129 472.0
10 TraesCS4B01G252800 chr5B 87.736 424 21 8 138 530 629273763 629274186 1.320000e-127 466.0
11 TraesCS4B01G252800 chr1D 92.066 1336 65 20 1092 2407 208183979 208185293 0.000000e+00 1842.0
12 TraesCS4B01G252800 chr1D 88.409 509 34 15 1 505 208183496 208183983 7.520000e-165 590.0
13 TraesCS4B01G252800 chr2D 89.133 773 33 17 138 860 25857504 25858275 0.000000e+00 915.0
14 TraesCS4B01G252800 chr2D 89.565 345 26 3 1508 1846 301363169 301363509 1.730000e-116 429.0
15 TraesCS4B01G252800 chr7A 88.846 771 37 15 138 860 632040069 632039300 0.000000e+00 902.0
16 TraesCS4B01G252800 chr5D 87.815 755 57 17 138 860 553279034 553279785 0.000000e+00 852.0
17 TraesCS4B01G252800 chr5A 88.868 530 27 13 362 860 2993859 2993331 7.410000e-175 623.0
18 TraesCS4B01G252800 chr2A 87.886 421 22 5 138 530 203821379 203820960 3.680000e-128 468.0
19 TraesCS4B01G252800 chrUn 87.774 319 25 6 1534 1846 38168896 38169206 6.420000e-96 361.0
20 TraesCS4B01G252800 chr4D 86.513 304 19 5 231 513 122253722 122254024 5.070000e-82 315.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G252800 chr4B 518681729 518684169 2440 False 4508 4508 100.0000 1 2441 1 chr4B.!!$F1 2440
1 TraesCS4B01G252800 chr1B 119683881 119686323 2442 True 4410 4410 99.2630 1 2441 1 chr1B.!!$R1 2440
2 TraesCS4B01G252800 chr6B 159422523 159424964 2441 True 4209 4209 97.7900 1 2441 1 chr6B.!!$R1 2440
3 TraesCS4B01G252800 chr6B 345157554 345158335 781 False 769 769 85.7140 138 860 1 chr6B.!!$F1 722
4 TraesCS4B01G252800 chr1A 350404559 350406998 2439 True 4196 4196 97.7080 1 2441 1 chr1A.!!$R1 2440
5 TraesCS4B01G252800 chr6D 69019447 69021885 2438 False 3705 3705 94.3060 1 2407 1 chr6D.!!$F1 2406
6 TraesCS4B01G252800 chr5B 698067447 698068987 1540 True 2259 2259 93.0920 861 2407 1 chr5B.!!$R1 1546
7 TraesCS4B01G252800 chr1D 208183496 208185293 1797 False 1216 1842 90.2375 1 2407 2 chr1D.!!$F1 2406
8 TraesCS4B01G252800 chr2D 25857504 25858275 771 False 915 915 89.1330 138 860 1 chr2D.!!$F1 722
9 TraesCS4B01G252800 chr7A 632039300 632040069 769 True 902 902 88.8460 138 860 1 chr7A.!!$R1 722
10 TraesCS4B01G252800 chr5D 553279034 553279785 751 False 852 852 87.8150 138 860 1 chr5D.!!$F1 722
11 TraesCS4B01G252800 chr5A 2993331 2993859 528 True 623 623 88.8680 362 860 1 chr5A.!!$R1 498

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
911 1013 0.609662 GGTGCATTGCAAGGTCCAAT 59.39 50.0 13.94 0.0 41.47 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2005 2110 4.838986 AGGGAGTAAGAAAGTAAGCACTGA 59.161 41.667 0.0 0.0 34.36 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
911 1013 0.609662 GGTGCATTGCAAGGTCCAAT 59.390 50.000 13.94 0.0 41.47 3.16
1074 1177 1.883021 GCCAGCTATTGTTTGGCGT 59.117 52.632 8.48 0.0 46.82 5.68
1202 1305 9.736023 CTATTCCCAATTTTACAAACTGCTATC 57.264 33.333 0.00 0.0 0.00 2.08
1532 1635 9.801873 ATTGTAACATCCATACTAATTTGTTGC 57.198 29.630 0.00 0.0 32.57 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
929 1031 8.757164 TTCCAATACATATCTGTTAGTATGCG 57.243 34.615 0.00 0.0 36.79 4.73
1074 1177 4.082523 CGCCCTTCTCCTTGCCGA 62.083 66.667 0.00 0.0 0.00 5.54
1151 1254 8.061304 AGGGCAATATGAGGAAAATAGAGAAAA 58.939 33.333 0.00 0.0 0.00 2.29
1202 1305 2.562912 GTGGCCATTGTGCGTCAG 59.437 61.111 9.72 0.0 0.00 3.51
1287 1390 3.305181 TGGTGAGCAGCAGGAGATA 57.695 52.632 0.00 0.0 34.41 1.98
1588 1691 3.845781 TTGGCATAGGAGGAGACAATC 57.154 47.619 0.00 0.0 0.00 2.67
2005 2110 4.838986 AGGGAGTAAGAAAGTAAGCACTGA 59.161 41.667 0.00 0.0 34.36 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.