Multiple sequence alignment - TraesCS4B01G238400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G238400 chr4B 100.000 2273 0 0 1 2273 495577615 495579887 0.000000e+00 4198.0
1 TraesCS4B01G238400 chr2B 98.857 2274 25 1 1 2273 449208696 449210969 0.000000e+00 4054.0
2 TraesCS4B01G238400 chr2B 98.724 2273 29 0 1 2273 234530528 234532800 0.000000e+00 4037.0
3 TraesCS4B01G238400 chr3A 98.768 2273 28 0 1 2273 495091908 495094180 0.000000e+00 4043.0
4 TraesCS4B01G238400 chr7A 98.680 2273 30 0 1 2273 60220133 60222405 0.000000e+00 4032.0
5 TraesCS4B01G238400 chr3B 98.681 2274 29 1 1 2273 6000134 6002407 0.000000e+00 4032.0
6 TraesCS4B01G238400 chr3B 97.536 2273 32 4 1 2273 92286135 92288383 0.000000e+00 3866.0
7 TraesCS4B01G238400 chr3B 97.868 938 12 1 1344 2273 101914924 101915861 0.000000e+00 1615.0
8 TraesCS4B01G238400 chr3B 97.122 938 19 1 1344 2273 201530772 201531709 0.000000e+00 1576.0
9 TraesCS4B01G238400 chr3B 95.549 337 7 1 1344 1672 201547118 201546782 1.200000e-147 532.0
10 TraesCS4B01G238400 chr3B 95.789 95 3 1 240 333 476429283 476429377 3.910000e-33 152.0
11 TraesCS4B01G238400 chr3B 97.368 76 2 0 715 790 39877608 39877683 1.830000e-26 130.0
12 TraesCS4B01G238400 chr3B 97.368 76 2 0 715 790 173945768 173945843 1.830000e-26 130.0
13 TraesCS4B01G238400 chr3B 96.923 65 2 0 180 244 359976113 359976177 2.390000e-20 110.0
14 TraesCS4B01G238400 chr3B 86.598 97 4 1 30 117 797540134 797540230 5.170000e-17 99.0
15 TraesCS4B01G238400 chr3B 93.651 63 4 0 55 117 797521528 797521590 6.680000e-16 95.3
16 TraesCS4B01G238400 chr1B 98.196 2273 41 0 1 2273 619184699 619186971 0.000000e+00 3971.0
17 TraesCS4B01G238400 chr2A 94.762 210 11 0 484 693 24962418 24962209 6.050000e-86 327.0
18 TraesCS4B01G238400 chr2A 98.125 160 3 0 1114 1273 537269588 537269429 1.720000e-71 279.0
19 TraesCS4B01G238400 chr2A 97.143 105 2 1 833 936 24354989 24355093 2.320000e-40 176.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G238400 chr4B 495577615 495579887 2272 False 4198 4198 100.000 1 2273 1 chr4B.!!$F1 2272
1 TraesCS4B01G238400 chr2B 449208696 449210969 2273 False 4054 4054 98.857 1 2273 1 chr2B.!!$F2 2272
2 TraesCS4B01G238400 chr2B 234530528 234532800 2272 False 4037 4037 98.724 1 2273 1 chr2B.!!$F1 2272
3 TraesCS4B01G238400 chr3A 495091908 495094180 2272 False 4043 4043 98.768 1 2273 1 chr3A.!!$F1 2272
4 TraesCS4B01G238400 chr7A 60220133 60222405 2272 False 4032 4032 98.680 1 2273 1 chr7A.!!$F1 2272
5 TraesCS4B01G238400 chr3B 6000134 6002407 2273 False 4032 4032 98.681 1 2273 1 chr3B.!!$F1 2272
6 TraesCS4B01G238400 chr3B 92286135 92288383 2248 False 3866 3866 97.536 1 2273 1 chr3B.!!$F3 2272
7 TraesCS4B01G238400 chr3B 101914924 101915861 937 False 1615 1615 97.868 1344 2273 1 chr3B.!!$F4 929
8 TraesCS4B01G238400 chr3B 201530772 201531709 937 False 1576 1576 97.122 1344 2273 1 chr3B.!!$F6 929
9 TraesCS4B01G238400 chr1B 619184699 619186971 2272 False 3971 3971 98.196 1 2273 1 chr1B.!!$F1 2272

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
622 623 1.608336 AGTCCGACGTCAATCCCCA 60.608 57.895 17.16 0.0 0.0 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2052 2063 2.046023 CTGGCGTGGATGGCAAGA 60.046 61.111 0.0 0.0 44.45 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
303 304 5.567138 GCTATTCAAAGCTTTTCTGGCTA 57.433 39.130 9.53 0.00 39.30 3.93
307 308 7.148239 GCTATTCAAAGCTTTTCTGGCTAACTA 60.148 37.037 9.53 0.00 39.30 2.24
522 523 3.679917 CGCCTAGATTCTGGACACATTGT 60.680 47.826 0.00 0.00 0.00 2.71
622 623 1.608336 AGTCCGACGTCAATCCCCA 60.608 57.895 17.16 0.00 0.00 4.96
845 846 6.478129 TGGTATAAGGAAGGAAATCAAACGT 58.522 36.000 0.00 0.00 0.00 3.99
1307 1310 7.778382 ACAGGAGAGTTACCAAATACAAAGTTT 59.222 33.333 0.00 0.00 0.00 2.66
1347 1350 7.840931 TCTCTTCTTTCTTTTCTTTTTGCCTT 58.159 30.769 0.00 0.00 0.00 4.35
1660 1671 4.258543 TGGTTCGGTATGGAATGAACTTC 58.741 43.478 4.23 0.00 40.34 3.01
2052 2063 7.978099 ATTGAAACCAAGAAATATAGGCCTT 57.022 32.000 12.58 0.81 0.00 4.35
2065 2076 3.190878 GCCTTCTTGCCATCCACG 58.809 61.111 0.00 0.00 0.00 4.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 7.347222 ACTTTTTCCCCTTTCCTCTATTTGTTT 59.653 33.333 0.00 0.00 0.00 2.83
504 505 5.482163 TCACACAATGTGTCCAGAATCTA 57.518 39.130 17.04 0.00 43.92 1.98
522 523 8.515695 TCTCCGTTCTTTAGAGTAATATCACA 57.484 34.615 0.00 0.00 0.00 3.58
641 642 1.937899 CGACCGTTTTGGAGTCTGTTT 59.062 47.619 0.00 0.00 42.00 2.83
845 846 4.775253 ACCCTTTTTCCTTCTCAAACAACA 59.225 37.500 0.00 0.00 0.00 3.33
1307 1310 5.277857 AGAAGAGAACGAAAGGAGAACAA 57.722 39.130 0.00 0.00 0.00 2.83
1347 1350 6.451064 TCGAAGCTATTTGATGTCTGACTA 57.549 37.500 9.51 0.00 0.00 2.59
1426 1437 8.956533 TGAATCGAGAAATTGGATTGTACATA 57.043 30.769 0.00 0.00 34.78 2.29
1660 1671 3.528009 TCGACTCGATCATCAGATTCG 57.472 47.619 10.72 10.72 39.72 3.34
2011 2022 3.628008 TCAATAGGACTCCTTACGAGCA 58.372 45.455 1.94 0.00 43.01 4.26
2052 2063 2.046023 CTGGCGTGGATGGCAAGA 60.046 61.111 0.00 0.00 44.45 3.02
2065 2076 5.844004 TCGGAAAACTCTATCTATTCTGGC 58.156 41.667 0.00 0.00 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.