Multiple sequence alignment - TraesCS4B01G238000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G238000 chr4B 100.000 2351 0 0 1 2351 495538667 495536317 0 4342
1 TraesCS4B01G238000 chrUn 98.300 2353 37 3 1 2351 233526161 233523810 0 4120
2 TraesCS4B01G238000 chrUn 98.134 2358 36 4 1 2351 257943219 257945575 0 4104
3 TraesCS4B01G238000 chr4D 97.668 2358 48 3 1 2351 123688068 123690425 0 4043
4 TraesCS4B01G238000 chr6B 98.427 2288 34 1 66 2351 128890812 128888525 0 4024
5 TraesCS4B01G238000 chr2D 97.455 2358 52 4 1 2351 637309598 637307242 0 4015
6 TraesCS4B01G238000 chr2D 97.287 2359 50 8 1 2351 306151994 306154346 0 3989
7 TraesCS4B01G238000 chr7A 98.339 2288 36 1 66 2351 60097027 60094740 0 4013
8 TraesCS4B01G238000 chr7B 98.209 2289 38 1 66 2351 716796668 716794380 0 3997


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G238000 chr4B 495536317 495538667 2350 True 4342 4342 100.000 1 2351 1 chr4B.!!$R1 2350
1 TraesCS4B01G238000 chrUn 233523810 233526161 2351 True 4120 4120 98.300 1 2351 1 chrUn.!!$R1 2350
2 TraesCS4B01G238000 chrUn 257943219 257945575 2356 False 4104 4104 98.134 1 2351 1 chrUn.!!$F1 2350
3 TraesCS4B01G238000 chr4D 123688068 123690425 2357 False 4043 4043 97.668 1 2351 1 chr4D.!!$F1 2350
4 TraesCS4B01G238000 chr6B 128888525 128890812 2287 True 4024 4024 98.427 66 2351 1 chr6B.!!$R1 2285
5 TraesCS4B01G238000 chr2D 637307242 637309598 2356 True 4015 4015 97.455 1 2351 1 chr2D.!!$R1 2350
6 TraesCS4B01G238000 chr2D 306151994 306154346 2352 False 3989 3989 97.287 1 2351 1 chr2D.!!$F1 2350
7 TraesCS4B01G238000 chr7A 60094740 60097027 2287 True 4013 4013 98.339 66 2351 1 chr7A.!!$R1 2285
8 TraesCS4B01G238000 chr7B 716794380 716796668 2288 True 3997 3997 98.209 66 2351 1 chr7B.!!$R1 2285

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
913 919 1.242076 GCAGCACTGAACATGGTTCT 58.758 50.0 10.14 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2187 2199 0.763223 CGGCTCTATACCCCAACCCT 60.763 60.0 0.0 0.0 0.0 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
166 167 5.922053 TGAAGTCTTGTATATGCTGCTCAT 58.078 37.500 0.00 0.0 39.17 2.90
301 305 5.862845 TGGTAAACGAACAAATAGGTGGTA 58.137 37.500 0.00 0.0 0.00 3.25
306 310 7.754851 AAACGAACAAATAGGTGGTATTTCT 57.245 32.000 0.00 0.0 39.00 2.52
383 387 5.683681 GTTATTTCGTAATCCCCAGGGTAA 58.316 41.667 4.22 0.0 36.47 2.85
425 429 8.013947 CACAGTGACAAGTCATTTTCTCATTAG 58.986 37.037 6.15 0.0 42.18 1.73
554 560 5.417811 GTTAGCACCTTTCTTAGTACTCCC 58.582 45.833 0.00 0.0 0.00 4.30
598 604 7.801716 TTTCGTGCATTAAGCTTAGGAATAT 57.198 32.000 6.24 0.0 45.94 1.28
863 869 5.975693 AATTGAATAAAAACGAGGAGCCA 57.024 34.783 0.00 0.0 0.00 4.75
888 894 2.040442 TAGGGGGCTACAGCTGCA 59.960 61.111 15.27 0.0 41.70 4.41
913 919 1.242076 GCAGCACTGAACATGGTTCT 58.758 50.000 10.14 0.0 0.00 3.01
1085 1092 3.501349 TGGATGGAATTGGACCGAAAAA 58.499 40.909 0.00 0.0 0.00 1.94
1226 1233 2.011122 TTGAAGAGGGGAGAACGAGT 57.989 50.000 0.00 0.0 0.00 4.18
1449 1456 6.053632 TGGTACTTGTCTGATCAATCACAT 57.946 37.500 0.00 0.0 32.50 3.21
1492 1499 2.804697 TCGTTCGATGTCTTGAACCA 57.195 45.000 0.00 0.0 41.12 3.67
1547 1554 3.314331 CCACTCCACGTCTGGCCT 61.314 66.667 3.32 0.0 37.49 5.19
1579 1586 2.016393 CTCACTTCGCCCGCCTATCA 62.016 60.000 0.00 0.0 0.00 2.15
1633 1640 2.435059 GCCTCTGACGGCTTCACC 60.435 66.667 9.86 0.0 46.63 4.02
1636 1643 0.824109 CCTCTGACGGCTTCACCATA 59.176 55.000 0.00 0.0 39.03 2.74
1999 2011 5.531287 GCCGATCCTAACATAATTTTGGAGT 59.469 40.000 0.89 0.0 34.46 3.85
2145 2157 2.678934 AGCTTCCACGGTCCGCTA 60.679 61.111 12.28 0.0 0.00 4.26
2187 2199 2.300967 CCCAGGGCCAGAGCAAGTA 61.301 63.158 6.18 0.0 42.56 2.24
2298 2310 4.712829 TGTTGGGAACGTCCTCTATATTCA 59.287 41.667 0.00 0.0 36.57 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
166 167 4.422546 AGAAAAACGACCAAAACGACAA 57.577 36.364 0.00 0.00 34.70 3.18
193 197 3.633065 CCACCTCCCTTTTTCGTAACAAA 59.367 43.478 0.00 0.00 0.00 2.83
301 305 8.791327 AACTTTTGTTTCACATTTCCAGAAAT 57.209 26.923 0.00 0.00 40.17 2.17
383 387 4.777896 TCACTGTGAAGCTAAAGGGTATCT 59.222 41.667 8.27 0.00 0.00 1.98
425 429 6.866010 AAATGGAAAATGAAAGAGCCAAAC 57.134 33.333 0.00 0.00 0.00 2.93
554 560 8.113062 CACGAAAACAATAAGAGATTAGCTCAG 58.887 37.037 0.00 0.00 46.45 3.35
598 604 6.294453 CCGGCCATCATATTAGCAAATAAACA 60.294 38.462 2.24 0.00 31.44 2.83
863 869 2.439880 GCTGTAGCCCCCTAGAATCTTT 59.560 50.000 0.00 0.00 34.31 2.52
888 894 2.223876 CCATGTTCAGTGCTGCAAAAGT 60.224 45.455 2.77 0.00 0.00 2.66
913 919 4.481368 AACGCAATATCTTGAGTACCCA 57.519 40.909 0.80 0.00 43.46 4.51
1449 1456 9.232082 CGAAAAATCAAGTGAACTAATGAACAA 57.768 29.630 0.00 0.00 0.00 2.83
1547 1554 1.000163 GAAGTGAGCGAGACCAAGACA 60.000 52.381 0.00 0.00 0.00 3.41
1579 1586 1.286260 GACGAAGCCGAGCCGATAT 59.714 57.895 0.00 0.00 39.50 1.63
1633 1640 5.767665 AGAGTACTACCAGTCATGAGCTATG 59.232 44.000 0.00 0.00 38.17 2.23
1636 1643 4.243793 AGAGTACTACCAGTCATGAGCT 57.756 45.455 0.00 0.00 0.00 4.09
1709 1721 9.733556 TTAATTAGTACAAGAAAGAGGCATTCA 57.266 29.630 0.00 0.00 0.00 2.57
1999 2011 3.818787 GGCTTCGTCGTCCGGCTA 61.819 66.667 0.00 0.00 37.11 3.93
2055 2067 6.465894 CCTGACCCCTATAAAAATCTAGTGGG 60.466 46.154 0.00 0.00 34.32 4.61
2145 2157 1.517832 CCGCATCTCTTCCTCGGTT 59.482 57.895 0.00 0.00 35.75 4.44
2187 2199 0.763223 CGGCTCTATACCCCAACCCT 60.763 60.000 0.00 0.00 0.00 4.34
2298 2310 7.041098 CGTAATGCTCCTAGAAAGGCATATTTT 60.041 37.037 10.39 2.27 43.39 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.