Multiple sequence alignment - TraesCS4B01G237900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G237900 chr4B 100.000 2342 0 0 1 2342 495537575 495535234 0 4325
1 TraesCS4B01G237900 chr7B 98.676 2342 30 1 1 2342 698126733 698124393 0 4152
2 TraesCS4B01G237900 chr7B 98.164 2342 43 0 1 2342 716795638 716793297 0 4087
3 TraesCS4B01G237900 chr7B 98.164 2342 39 2 1 2342 742937682 742940019 0 4084
4 TraesCS4B01G237900 chrUn 98.591 2342 33 0 1 2342 233525068 233522727 0 4143
5 TraesCS4B01G237900 chrUn 98.509 2347 30 1 1 2342 257944312 257946658 0 4135
6 TraesCS4B01G237900 chr7A 98.420 2342 37 0 1 2342 60095998 60093657 0 4120
7 TraesCS4B01G237900 chr1D 98.210 2347 37 1 1 2342 212429069 212431415 0 4096
8 TraesCS4B01G237900 chr6B 98.036 2342 46 0 1 2342 128889783 128887442 0 4071
9 TraesCS4B01G237900 chr5B 97.908 2342 49 0 1 2342 713112763 713110422 0 4054


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G237900 chr4B 495535234 495537575 2341 True 4325 4325 100.000 1 2342 1 chr4B.!!$R1 2341
1 TraesCS4B01G237900 chr7B 698124393 698126733 2340 True 4152 4152 98.676 1 2342 1 chr7B.!!$R1 2341
2 TraesCS4B01G237900 chr7B 716793297 716795638 2341 True 4087 4087 98.164 1 2342 1 chr7B.!!$R2 2341
3 TraesCS4B01G237900 chr7B 742937682 742940019 2337 False 4084 4084 98.164 1 2342 1 chr7B.!!$F1 2341
4 TraesCS4B01G237900 chrUn 233522727 233525068 2341 True 4143 4143 98.591 1 2342 1 chrUn.!!$R1 2341
5 TraesCS4B01G237900 chrUn 257944312 257946658 2346 False 4135 4135 98.509 1 2342 1 chrUn.!!$F1 2341
6 TraesCS4B01G237900 chr7A 60093657 60095998 2341 True 4120 4120 98.420 1 2342 1 chr7A.!!$R1 2341
7 TraesCS4B01G237900 chr1D 212429069 212431415 2346 False 4096 4096 98.210 1 2342 1 chr1D.!!$F1 2341
8 TraesCS4B01G237900 chr6B 128887442 128889783 2341 True 4071 4071 98.036 1 2342 1 chr6B.!!$R1 2341
9 TraesCS4B01G237900 chr5B 713110422 713112763 2341 True 4054 4054 97.908 1 2342 1 chr5B.!!$R1 2341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
544 545 0.824109 CCTCTGACGGCTTCACCATA 59.176 55.0 0.0 0.0 39.03 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1628 1634 0.458669 GATTCGGACCGCCACTTCTA 59.541 55.0 9.66 0.0 0.0 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
134 135 2.011122 TTGAAGAGGGGAGAACGAGT 57.989 50.000 0.00 0.00 0.00 4.18
319 320 2.638480 TCCCTTGCTAAAGCGCATAT 57.362 45.000 11.47 0.00 45.83 1.78
357 358 6.053632 TGGTACTTGTCTGATCAATCACAT 57.946 37.500 0.00 0.00 32.50 3.21
455 456 3.314331 CCACTCCACGTCTGGCCT 61.314 66.667 3.32 0.00 37.49 5.19
487 488 2.016393 CTCACTTCGCCCGCCTATCA 62.016 60.000 0.00 0.00 0.00 2.15
541 542 2.435059 GCCTCTGACGGCTTCACC 60.435 66.667 9.86 0.00 46.63 4.02
544 545 0.824109 CCTCTGACGGCTTCACCATA 59.176 55.000 0.00 0.00 39.03 2.74
907 913 5.531287 GCCGATCCTAACATAATTTTGGAGT 59.469 40.000 0.89 0.00 34.46 3.85
1053 1059 2.678934 AGCTTCCACGGTCCGCTA 60.679 61.111 12.28 0.00 0.00 4.26
1095 1101 2.300967 CCCAGGGCCAGAGCAAGTA 61.301 63.158 6.18 0.00 42.56 2.24
1206 1212 4.712829 TGTTGGGAACGTCCTCTATATTCA 59.287 41.667 0.00 0.00 36.57 2.57
1628 1634 2.494870 GAGGCAAGAACCATGCTTTCAT 59.505 45.455 7.74 0.00 43.34 2.57
1834 1840 1.345089 TCATTTCGTGAAAGTCCCCGA 59.655 47.619 1.20 0.00 32.78 5.14
2100 2106 4.560128 CCAAAGAAAGATGAGACGAGACA 58.440 43.478 0.00 0.00 0.00 3.41
2177 2183 8.679100 GCTAACATAGATATCTATTCTCGGTGT 58.321 37.037 20.53 13.21 37.07 4.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 320 4.164843 AGTACCAAGGAGCAAGAAAACA 57.835 40.909 0.00 0.00 0.00 2.83
357 358 9.232082 CGAAAAATCAAGTGAACTAATGAACAA 57.768 29.630 0.00 0.00 0.00 2.83
455 456 1.000163 GAAGTGAGCGAGACCAAGACA 60.000 52.381 0.00 0.00 0.00 3.41
487 488 1.286260 GACGAAGCCGAGCCGATAT 59.714 57.895 0.00 0.00 39.50 1.63
541 542 5.767665 AGAGTACTACCAGTCATGAGCTATG 59.232 44.000 0.00 0.00 38.17 2.23
544 545 4.243793 AGAGTACTACCAGTCATGAGCT 57.756 45.455 0.00 0.00 0.00 4.09
617 623 9.733556 TTAATTAGTACAAGAAAGAGGCATTCA 57.266 29.630 0.00 0.00 0.00 2.57
907 913 3.818787 GGCTTCGTCGTCCGGCTA 61.819 66.667 0.00 0.00 37.11 3.93
963 969 6.465894 CCTGACCCCTATAAAAATCTAGTGGG 60.466 46.154 0.00 0.00 34.32 4.61
1053 1059 1.517832 CCGCATCTCTTCCTCGGTT 59.482 57.895 0.00 0.00 35.75 4.44
1095 1101 0.763223 CGGCTCTATACCCCAACCCT 60.763 60.000 0.00 0.00 0.00 4.34
1206 1212 7.041098 CGTAATGCTCCTAGAAAGGCATATTTT 60.041 37.037 10.39 2.27 43.39 1.82
1601 1607 1.839994 CATGGTTCTTGCCTCCCTCTA 59.160 52.381 0.00 0.00 0.00 2.43
1628 1634 0.458669 GATTCGGACCGCCACTTCTA 59.541 55.000 9.66 0.00 0.00 2.10
1834 1840 1.280457 CCTACAGCCCTTTCCTCTGT 58.720 55.000 0.00 0.00 42.89 3.41
1905 1911 1.069204 CATCTATACCAGCTGCCACGT 59.931 52.381 8.66 3.10 0.00 4.49
2100 2106 1.872197 GCTGCGTCCTCTGACAGTCT 61.872 60.000 1.59 0.00 41.85 3.24
2177 2183 9.770097 AAAGAGATTCTAAATCTCGAATATGCA 57.230 29.630 18.92 0.00 46.74 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.