Multiple sequence alignment - TraesCS4B01G237700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G237700 chr4B 100.000 2192 0 0 1 2192 495479711 495477520 0 4048
1 TraesCS4B01G237700 chr3A 97.902 2193 45 1 1 2192 495104759 495102567 0 3794
2 TraesCS4B01G237700 chr2B 97.629 2193 51 1 1 2192 234541159 234538967 0 3760
3 TraesCS4B01G237700 chr1A 97.629 2193 50 2 1 2192 278521195 278523386 0 3760
4 TraesCS4B01G237700 chrUn 97.536 2192 54 0 1 2192 217907669 217909860 0 3749
5 TraesCS4B01G237700 chr3B 97.536 2192 54 0 1 2192 6010765 6008574 0 3749
6 TraesCS4B01G237700 chr3B 97.449 2195 50 4 1 2192 92296731 92294540 0 3738
7 TraesCS4B01G237700 chr1B 97.538 2193 52 2 1 2192 619195330 619193139 0 3749
8 TraesCS4B01G237700 chr4A 97.173 2193 61 1 1 2192 67519499 67521691 0 3705


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G237700 chr4B 495477520 495479711 2191 True 4048 4048 100.000 1 2192 1 chr4B.!!$R1 2191
1 TraesCS4B01G237700 chr3A 495102567 495104759 2192 True 3794 3794 97.902 1 2192 1 chr3A.!!$R1 2191
2 TraesCS4B01G237700 chr2B 234538967 234541159 2192 True 3760 3760 97.629 1 2192 1 chr2B.!!$R1 2191
3 TraesCS4B01G237700 chr1A 278521195 278523386 2191 False 3760 3760 97.629 1 2192 1 chr1A.!!$F1 2191
4 TraesCS4B01G237700 chrUn 217907669 217909860 2191 False 3749 3749 97.536 1 2192 1 chrUn.!!$F1 2191
5 TraesCS4B01G237700 chr3B 6008574 6010765 2191 True 3749 3749 97.536 1 2192 1 chr3B.!!$R1 2191
6 TraesCS4B01G237700 chr3B 92294540 92296731 2191 True 3738 3738 97.449 1 2192 1 chr3B.!!$R2 2191
7 TraesCS4B01G237700 chr1B 619193139 619195330 2191 True 3749 3749 97.538 1 2192 1 chr1B.!!$R1 2191
8 TraesCS4B01G237700 chr4A 67519499 67521691 2192 False 3705 3705 97.173 1 2192 1 chr4A.!!$F1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
609 610 0.098728 CGGGCCATCAACATTCGAAC 59.901 55.0 4.39 0.0 0.0 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1856 1860 0.258774 CCTTTCCCCCGGATCAATGT 59.741 55.0 0.73 0.0 0.0 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
239 240 6.118170 AGATATTGATTCCTCCACACAACAG 58.882 40.000 0.00 0.00 0.00 3.16
278 279 6.030849 CGACGAATTAGAAGAGATGTCAACT 58.969 40.000 0.00 0.00 0.00 3.16
332 333 2.928801 TTGGTACTGTCACTGCACAT 57.071 45.000 0.00 0.00 0.00 3.21
609 610 0.098728 CGGGCCATCAACATTCGAAC 59.901 55.000 4.39 0.00 0.00 3.95
610 611 1.173043 GGGCCATCAACATTCGAACA 58.827 50.000 4.39 0.00 0.00 3.18
823 824 0.321298 AAAAAGCGAAGGCCGAGCTA 60.321 50.000 19.95 0.00 40.78 3.32
908 909 1.277326 CTCGCCAAATTCGTCGATCA 58.723 50.000 0.00 0.00 0.00 2.92
994 995 1.778803 CCCCTTTCCCCCTATCCCC 60.779 68.421 0.00 0.00 0.00 4.81
1427 1431 5.123820 CACCTTACGATGTTCATGACCAATT 59.876 40.000 0.00 0.00 0.00 2.32
1594 1598 3.613671 GCTATGTCCTCCATCACGATCTG 60.614 52.174 0.00 0.00 34.86 2.90
1646 1650 2.094442 TGTGAAACGTAGATCATCGCCA 60.094 45.455 8.96 3.69 42.39 5.69
1815 1819 2.589540 CCCCGGCATAGTGCTTCA 59.410 61.111 0.00 0.00 44.28 3.02
1856 1860 5.187967 GGAATCAACTGACTTCTCCCTTCTA 59.812 44.000 0.00 0.00 0.00 2.10
1910 1914 3.840666 AGTTGGGAAGCTAGACATCAAGA 59.159 43.478 0.00 0.00 0.00 3.02
1942 1946 6.737720 TGATGAGGATAACTAAGCTGACAT 57.262 37.500 0.00 0.00 0.00 3.06
2065 2069 1.066573 CCAGGATCAGAACGAGCTTGT 60.067 52.381 0.00 0.00 35.47 3.16
2114 2118 2.045242 AGCTGGAGTGCTGCCATG 60.045 61.111 9.88 0.00 42.33 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
201 202 5.219343 TCAATATCTCGACATGAGCCAAT 57.781 39.130 0.00 0.00 44.86 3.16
208 209 5.636965 GTGGAGGAATCAATATCTCGACATG 59.363 44.000 0.00 0.00 35.83 3.21
278 279 1.072489 TGTTTCCAGATACGGTTGCCA 59.928 47.619 0.00 0.00 0.00 4.92
332 333 2.925966 ATCCCCAATCCTTTGCTTGA 57.074 45.000 0.00 0.00 0.00 3.02
420 421 0.887387 GGCAGAACCGTTGTTGCCTA 60.887 55.000 21.23 0.00 39.35 3.93
602 603 2.930826 AGGACCAACACTGTTCGAAT 57.069 45.000 0.00 0.00 0.00 3.34
994 995 1.202770 CCCGCTCCTAAACATAAGGGG 60.203 57.143 0.00 0.00 40.51 4.79
1427 1431 3.021695 CCTACTGGTACGTCAAGATCCA 58.978 50.000 0.00 0.00 0.00 3.41
1594 1598 5.765182 ACGATTCCATGGATAGTTTCATTCC 59.235 40.000 17.06 0.00 0.00 3.01
1646 1650 6.600882 TTAACCTGAGTCTCGGTTAAGAAT 57.399 37.500 27.24 12.82 45.73 2.40
1712 1716 2.125552 CGAGATGCGCCAACCTCA 60.126 61.111 4.18 0.00 0.00 3.86
1809 1813 1.872237 CGAAGAACCGGAAGTGAAGCA 60.872 52.381 9.46 0.00 0.00 3.91
1856 1860 0.258774 CCTTTCCCCCGGATCAATGT 59.741 55.000 0.73 0.00 0.00 2.71
1910 1914 5.121380 AGTTATCCTCATCAAGCCACAAT 57.879 39.130 0.00 0.00 0.00 2.71
2081 2085 3.782523 TCCAGCTCACTAAAGAATGGGAT 59.217 43.478 0.00 0.00 0.00 3.85
2114 2118 3.573515 CGCGTTTTCCGTGGATAAC 57.426 52.632 10.96 10.96 43.26 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.