Multiple sequence alignment - TraesCS4B01G208300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G208300 chr4B 100.000 5516 0 0 1 5516 445324071 445329586 0.000000e+00 10187
1 TraesCS4B01G208300 chr4B 99.125 3428 28 1 2089 5514 622889480 622886053 0.000000e+00 6163
2 TraesCS4B01G208300 chr3B 99.271 3428 23 2 2089 5514 777042339 777038912 0.000000e+00 6191
3 TraesCS4B01G208300 chr6A 99.067 3430 27 3 2089 5514 46107043 46110471 0.000000e+00 6152
4 TraesCS4B01G208300 chr6A 99.038 3431 27 4 2089 5514 46137959 46141388 0.000000e+00 6148
5 TraesCS4B01G208300 chr6A 99.283 2091 14 1 1 2090 46104771 46106861 0.000000e+00 3777
6 TraesCS4B01G208300 chr6A 99.234 2090 16 0 1 2090 46135688 46137777 0.000000e+00 3771
7 TraesCS4B01G208300 chr1D 97.806 3191 61 5 2089 5277 42045860 42042677 0.000000e+00 5496
8 TraesCS4B01G208300 chr1D 97.274 3191 76 6 2089 5277 162592516 162595697 0.000000e+00 5400
9 TraesCS4B01G208300 chr1D 97.943 2090 43 0 1 2090 42048131 42046042 0.000000e+00 3622
10 TraesCS4B01G208300 chr1D 97.656 2090 49 0 1 2090 485430526 485428437 0.000000e+00 3589
11 TraesCS4B01G208300 chr1D 96.943 229 7 0 5282 5510 162595781 162596009 8.670000e-103 385
12 TraesCS4B01G208300 chr6D 97.425 3185 78 2 2089 5270 360754899 360751716 0.000000e+00 5424
13 TraesCS4B01G208300 chr6D 97.328 1909 48 1 182 2090 360756986 360755081 0.000000e+00 3240
14 TraesCS4B01G208300 chr7D 97.149 3192 83 4 2089 5277 346631651 346628465 0.000000e+00 5384
15 TraesCS4B01G208300 chr7D 97.081 2090 61 0 1 2090 346633922 346631833 0.000000e+00 3522
16 TraesCS4B01G208300 chr7D 96.552 232 8 0 5282 5513 346628423 346628192 8.670000e-103 385
17 TraesCS4B01G208300 chr7D 96.552 232 8 0 5282 5513 608292102 608291871 8.670000e-103 385
18 TraesCS4B01G208300 chr5D 95.070 3002 129 13 2089 5087 201749592 201746607 0.000000e+00 4706
19 TraesCS4B01G208300 chr2A 99.522 2090 10 0 1 2090 171832637 171834726 0.000000e+00 3805
20 TraesCS4B01G208300 chr2B 99.333 2098 13 1 1 2098 93118526 93120622 0.000000e+00 3795
21 TraesCS4B01G208300 chr7A 99.197 1869 15 0 1 1869 125407695 125405827 0.000000e+00 3369
22 TraesCS4B01G208300 chr5A 99.091 330 3 0 5185 5514 617311019 617310690 1.320000e-165 593


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G208300 chr4B 445324071 445329586 5515 False 10187.0 10187 100.000000 1 5516 1 chr4B.!!$F1 5515
1 TraesCS4B01G208300 chr4B 622886053 622889480 3427 True 6163.0 6163 99.125000 2089 5514 1 chr4B.!!$R1 3425
2 TraesCS4B01G208300 chr3B 777038912 777042339 3427 True 6191.0 6191 99.271000 2089 5514 1 chr3B.!!$R1 3425
3 TraesCS4B01G208300 chr6A 46104771 46110471 5700 False 4964.5 6152 99.175000 1 5514 2 chr6A.!!$F1 5513
4 TraesCS4B01G208300 chr6A 46135688 46141388 5700 False 4959.5 6148 99.136000 1 5514 2 chr6A.!!$F2 5513
5 TraesCS4B01G208300 chr1D 42042677 42048131 5454 True 4559.0 5496 97.874500 1 5277 2 chr1D.!!$R2 5276
6 TraesCS4B01G208300 chr1D 485428437 485430526 2089 True 3589.0 3589 97.656000 1 2090 1 chr1D.!!$R1 2089
7 TraesCS4B01G208300 chr1D 162592516 162596009 3493 False 2892.5 5400 97.108500 2089 5510 2 chr1D.!!$F1 3421
8 TraesCS4B01G208300 chr6D 360751716 360756986 5270 True 4332.0 5424 97.376500 182 5270 2 chr6D.!!$R1 5088
9 TraesCS4B01G208300 chr7D 346628192 346633922 5730 True 3097.0 5384 96.927333 1 5513 3 chr7D.!!$R2 5512
10 TraesCS4B01G208300 chr5D 201746607 201749592 2985 True 4706.0 4706 95.070000 2089 5087 1 chr5D.!!$R1 2998
11 TraesCS4B01G208300 chr2A 171832637 171834726 2089 False 3805.0 3805 99.522000 1 2090 1 chr2A.!!$F1 2089
12 TraesCS4B01G208300 chr2B 93118526 93120622 2096 False 3795.0 3795 99.333000 1 2098 1 chr2B.!!$F1 2097
13 TraesCS4B01G208300 chr7A 125405827 125407695 1868 True 3369.0 3369 99.197000 1 1869 1 chr7A.!!$R1 1868

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
449 450 8.190122 GCTGATTGTCCATTATTTGTACATTGA 58.810 33.333 0.0 0.0 0.00 2.57 F
1124 1126 2.566724 GGAAATCCCATTGTCCTTGCAA 59.433 45.455 0.0 0.0 34.14 4.08 F
2384 2569 4.551702 TGTGGCAGCTAGAGTATTTTCA 57.448 40.909 0.0 0.0 0.00 2.69 F
3151 3338 0.040067 GTGCGAAACAAGGCAAGAGG 60.040 55.000 0.0 0.0 41.46 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2063 2065 0.261696 TCCTGGATGATCTGGACCGA 59.738 55.000 0.0 0.0 31.19 4.69 R
2764 2950 0.620556 GGTTCTGGGATGAAGCCTCA 59.379 55.000 0.0 0.0 38.18 3.86 R
3356 3544 1.532868 GCTGCATTCAACTCTTCACGT 59.467 47.619 0.0 0.0 0.00 4.49 R
4869 5062 6.725364 ACTGAGTTGATCCATTGTTTCCTAT 58.275 36.000 0.0 0.0 0.00 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
449 450 8.190122 GCTGATTGTCCATTATTTGTACATTGA 58.810 33.333 0.00 0.0 0.00 2.57
1124 1126 2.566724 GGAAATCCCATTGTCCTTGCAA 59.433 45.455 0.00 0.0 34.14 4.08
2063 2065 5.426833 ACCTGATCCTTGCACTAGTTATTCT 59.573 40.000 0.00 0.0 0.00 2.40
2384 2569 4.551702 TGTGGCAGCTAGAGTATTTTCA 57.448 40.909 0.00 0.0 0.00 2.69
2450 2635 7.336931 TGAGAAAAATGTATCTGAGGCTTTACC 59.663 37.037 0.00 0.0 39.61 2.85
2454 2639 7.775053 AAATGTATCTGAGGCTTTACCAAAA 57.225 32.000 0.00 0.0 43.14 2.44
2764 2950 1.639635 CCTCCTGCCAGTTGCCCTAT 61.640 60.000 0.00 0.0 40.16 2.57
3151 3338 0.040067 GTGCGAAACAAGGCAAGAGG 60.040 55.000 0.00 0.0 41.46 3.69
3356 3544 3.820557 GCCTATTGCCCAAGAACTATCA 58.179 45.455 0.00 0.0 0.00 2.15
3931 4120 8.443953 AATTATCAAAGTATCCTTCACAGCTC 57.556 34.615 0.00 0.0 0.00 4.09
4324 4513 2.550277 TGTGGAGCTTGATCCCTCTA 57.450 50.000 2.26 0.0 38.72 2.43
4557 4746 6.260936 CACTTGTCATTTTCTGTCTTGGTACT 59.739 38.462 0.00 0.0 0.00 2.73
4869 5062 2.180276 GGTCTTCTTCTAGTGCCTCCA 58.820 52.381 0.00 0.0 0.00 3.86
5116 5309 1.935873 CAACGCTCGTGATCCATCAAT 59.064 47.619 0.00 0.0 38.75 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
449 450 5.452078 TGGATCGTGCAGAAAAGAAATTT 57.548 34.783 0.00 0.00 0.00 1.82
1124 1126 1.032014 ATGACCGCAAAAGCACTTGT 58.968 45.000 0.00 0.00 0.00 3.16
2063 2065 0.261696 TCCTGGATGATCTGGACCGA 59.738 55.000 0.00 0.00 31.19 4.69
2450 2635 6.632909 TCAGGAATATCAAGGCATGTTTTTG 58.367 36.000 0.00 0.00 0.00 2.44
2454 2639 5.378230 TCTCAGGAATATCAAGGCATGTT 57.622 39.130 0.00 0.00 0.00 2.71
2764 2950 0.620556 GGTTCTGGGATGAAGCCTCA 59.379 55.000 0.00 0.00 38.18 3.86
3151 3338 2.084546 CTTCAACGATTGAACCCTCCC 58.915 52.381 8.47 0.00 44.21 4.30
3346 3534 6.085555 TCAACTCTTCACGTGATAGTTCTT 57.914 37.500 29.63 16.28 32.02 2.52
3356 3544 1.532868 GCTGCATTCAACTCTTCACGT 59.467 47.619 0.00 0.00 0.00 4.49
3446 3634 7.649306 ACATCTTGCACACTTCAATTCTAAAAC 59.351 33.333 0.00 0.00 0.00 2.43
3931 4120 8.480643 AAGAGTACCATCTCAATTTTTCTACG 57.519 34.615 0.00 0.00 36.97 3.51
4869 5062 6.725364 ACTGAGTTGATCCATTGTTTCCTAT 58.275 36.000 0.00 0.00 0.00 2.57
5258 5451 4.700692 TGTGCGCATATACTTACCCAAAAA 59.299 37.500 15.91 0.00 0.00 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.