Multiple sequence alignment - TraesCS4B01G181300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G181300 chr4B 100.000 5627 0 0 1 5627 398198730 398193104 0.000000e+00 10392.0
1 TraesCS4B01G181300 chr4B 97.692 3336 23 5 2318 5627 398161651 398158344 0.000000e+00 5685.0
2 TraesCS4B01G181300 chr4B 98.415 2902 17 4 2318 5196 398126742 398123847 0.000000e+00 5077.0
3 TraesCS4B01G181300 chr4B 99.294 1557 5 3 22 1573 398163771 398162216 0.000000e+00 2809.0
4 TraesCS4B01G181300 chr4B 98.876 534 6 0 5094 5627 398123845 398123312 0.000000e+00 953.0
5 TraesCS4B01G181300 chr4B 99.349 461 2 1 22 482 398129402 398128943 0.000000e+00 833.0
6 TraesCS4B01G181300 chr4B 97.727 44 0 1 25 67 349241954 349241997 2.170000e-09 75.0
7 TraesCS4B01G181300 chr4B 91.837 49 2 2 23 70 591696427 591696474 3.640000e-07 67.6
8 TraesCS4B01G181300 chrUn 99.803 1015 2 0 1025 2039 395340977 395339963 0.000000e+00 1864.0
9 TraesCS4B01G181300 chrUn 100.000 427 0 0 4355 4781 476478221 476477795 0.000000e+00 789.0
10 TraesCS4B01G181300 chrUn 100.000 294 0 0 2023 2316 395339783 395339490 1.380000e-150 544.0
11 TraesCS4B01G181300 chrUn 97.368 266 7 0 2592 2857 83540825 83541090 2.390000e-123 453.0
12 TraesCS4B01G181300 chr7D 87.819 1527 115 47 708 2173 149714732 149716248 0.000000e+00 1724.0
13 TraesCS4B01G181300 chr7D 91.597 357 26 4 5054 5408 578839847 578840201 1.820000e-134 490.0
14 TraesCS4B01G181300 chr7D 91.341 358 27 4 5054 5409 621221197 621220842 2.360000e-133 486.0
15 TraesCS4B01G181300 chr7D 91.772 316 26 0 3054 3369 149722229 149722544 1.860000e-119 440.0
16 TraesCS4B01G181300 chr7D 86.228 334 36 10 3723 4049 149722758 149723088 2.490000e-93 353.0
17 TraesCS4B01G181300 chr7D 87.633 283 20 7 2219 2501 149716245 149716512 1.180000e-81 315.0
18 TraesCS4B01G181300 chr7D 89.105 257 11 3 4046 4285 149733860 149734116 2.550000e-78 303.0
19 TraesCS4B01G181300 chr7D 82.443 131 9 3 2853 2970 149722070 149722199 9.970000e-18 102.0
20 TraesCS4B01G181300 chr7D 100.000 42 0 0 4318 4359 93543053 93543012 1.680000e-10 78.7
21 TraesCS4B01G181300 chr7D 89.286 56 5 1 4308 4362 426558942 426558887 1.010000e-07 69.4
22 TraesCS4B01G181300 chr7A 89.247 1367 100 24 1262 2593 150186972 150188326 0.000000e+00 1666.0
23 TraesCS4B01G181300 chr7A 85.764 569 68 10 704 1261 150186367 150186933 1.750000e-164 590.0
24 TraesCS4B01G181300 chr7A 85.946 555 56 9 3774 4307 150206364 150206917 1.760000e-159 573.0
25 TraesCS4B01G181300 chr7A 90.934 364 27 6 5054 5413 127659547 127659186 8.480000e-133 484.0
26 TraesCS4B01G181300 chr7A 91.961 311 25 0 3049 3359 150203041 150203351 2.410000e-118 436.0
27 TraesCS4B01G181300 chr7A 92.147 191 14 1 2853 3043 150188325 150188514 9.290000e-68 268.0
28 TraesCS4B01G181300 chr7A 86.667 210 20 5 3426 3634 150203470 150203672 5.670000e-55 226.0
29 TraesCS4B01G181300 chr7B 89.419 1342 87 22 1275 2593 111995025 111996334 0.000000e+00 1640.0
30 TraesCS4B01G181300 chr7B 87.312 599 40 18 3717 4285 111997022 111997614 0.000000e+00 652.0
31 TraesCS4B01G181300 chr7B 90.138 436 35 5 703 1131 111993943 111994377 1.370000e-155 560.0
32 TraesCS4B01G181300 chr7B 97.388 268 6 1 2592 2859 153573422 153573156 6.650000e-124 455.0
33 TraesCS4B01G181300 chr7B 91.772 316 26 0 3054 3369 111996493 111996808 1.860000e-119 440.0
34 TraesCS4B01G181300 chr7B 92.576 229 12 5 3407 3634 111996806 111997030 1.960000e-84 324.0
35 TraesCS4B01G181300 chr7B 89.189 74 6 2 2898 2970 111996391 111996463 2.160000e-14 91.6
36 TraesCS4B01G181300 chr2A 95.157 351 16 1 5061 5411 761625876 761626225 2.290000e-153 553.0
37 TraesCS4B01G181300 chr2A 96.899 258 8 0 4791 5048 761625546 761625803 3.110000e-117 433.0
38 TraesCS4B01G181300 chr3B 92.416 356 24 3 5054 5408 80093792 80093439 6.510000e-139 505.0
39 TraesCS4B01G181300 chr3B 96.139 259 10 0 4790 5048 80094117 80093859 1.870000e-114 424.0
40 TraesCS4B01G181300 chr3B 100.000 43 0 0 25 67 162501814 162501772 4.670000e-11 80.5
41 TraesCS4B01G181300 chr3B 97.674 43 1 0 4309 4351 65370240 65370282 2.170000e-09 75.0
42 TraesCS4B01G181300 chr3A 91.667 360 26 4 5054 5411 628702960 628703317 3.920000e-136 496.0
43 TraesCS4B01G181300 chr3A 91.413 361 26 5 5054 5411 696045553 696045911 1.820000e-134 490.0
44 TraesCS4B01G181300 chr3A 95.038 262 11 2 4788 5048 634712535 634712795 1.460000e-110 411.0
45 TraesCS4B01G181300 chr3A 94.297 263 13 2 4787 5048 696045227 696045488 8.780000e-108 401.0
46 TraesCS4B01G181300 chr3A 87.665 227 19 5 5410 5627 55482786 55482560 7.230000e-64 255.0
47 TraesCS4B01G181300 chr5B 97.388 268 6 1 2592 2858 708327527 708327794 6.650000e-124 455.0
48 TraesCS4B01G181300 chr5B 97.727 44 1 0 25 68 166829062 166829105 6.050000e-10 76.8
49 TraesCS4B01G181300 chr5B 94.595 37 2 0 4749 4785 679578248 679578284 2.190000e-04 58.4
50 TraesCS4B01G181300 chr5A 97.037 270 8 0 2592 2861 596587302 596587571 6.650000e-124 455.0
51 TraesCS4B01G181300 chr5A 97.026 269 8 0 2592 2860 490049347 490049079 2.390000e-123 453.0
52 TraesCS4B01G181300 chr2B 97.719 263 6 0 2592 2854 450718232 450718494 2.390000e-123 453.0
53 TraesCS4B01G181300 chr2B 79.310 145 22 7 5452 5593 282781644 282781783 1.670000e-15 95.3
54 TraesCS4B01G181300 chr6B 95.699 279 11 1 2592 2870 712458222 712457945 1.110000e-121 448.0
55 TraesCS4B01G181300 chr6B 85.294 68 8 2 4318 4384 113712247 113712181 1.010000e-07 69.4
56 TraesCS4B01G181300 chr6B 91.837 49 3 1 25 73 505688733 505688780 3.640000e-07 67.6
57 TraesCS4B01G181300 chr1D 95.402 261 8 3 4791 5048 478814817 478814558 4.060000e-111 412.0
58 TraesCS4B01G181300 chr1D 97.674 43 1 0 25 67 314215397 314215439 2.170000e-09 75.0
59 TraesCS4B01G181300 chr1D 89.474 57 3 3 4304 4358 59875993 59875938 1.010000e-07 69.4
60 TraesCS4B01G181300 chr1B 95.720 257 9 2 4793 5048 18122775 18123030 4.060000e-111 412.0
61 TraesCS4B01G181300 chr3D 94.737 266 10 4 4784 5048 345757186 345757448 1.460000e-110 411.0
62 TraesCS4B01G181300 chr6D 100.000 42 0 0 4318 4359 446215241 446215200 1.680000e-10 78.7
63 TraesCS4B01G181300 chr5D 97.727 44 0 1 25 67 153656013 153655970 2.170000e-09 75.0
64 TraesCS4B01G181300 chr4D 95.652 46 2 0 4320 4365 150840431 150840386 2.170000e-09 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G181300 chr4B 398193104 398198730 5626 True 10392.000000 10392 100.000000 1 5627 1 chr4B.!!$R1 5626
1 TraesCS4B01G181300 chr4B 398158344 398163771 5427 True 4247.000000 5685 98.493000 22 5627 2 chr4B.!!$R3 5605
2 TraesCS4B01G181300 chr4B 398123312 398129402 6090 True 2287.666667 5077 98.880000 22 5627 3 chr4B.!!$R2 5605
3 TraesCS4B01G181300 chrUn 395339490 395340977 1487 True 1204.000000 1864 99.901500 1025 2316 2 chrUn.!!$R2 1291
4 TraesCS4B01G181300 chr7D 149714732 149716512 1780 False 1019.500000 1724 87.726000 708 2501 2 chr7D.!!$F3 1793
5 TraesCS4B01G181300 chr7D 149722070 149723088 1018 False 298.333333 440 86.814333 2853 4049 3 chr7D.!!$F4 1196
6 TraesCS4B01G181300 chr7A 150186367 150188514 2147 False 841.333333 1666 89.052667 704 3043 3 chr7A.!!$F1 2339
7 TraesCS4B01G181300 chr7A 150203041 150206917 3876 False 411.666667 573 88.191333 3049 4307 3 chr7A.!!$F2 1258
8 TraesCS4B01G181300 chr7B 111993943 111997614 3671 False 617.933333 1640 90.067667 703 4285 6 chr7B.!!$F1 3582
9 TraesCS4B01G181300 chr2A 761625546 761626225 679 False 493.000000 553 96.028000 4791 5411 2 chr2A.!!$F1 620
10 TraesCS4B01G181300 chr3B 80093439 80094117 678 True 464.500000 505 94.277500 4790 5408 2 chr3B.!!$R2 618
11 TraesCS4B01G181300 chr3A 696045227 696045911 684 False 445.500000 490 92.855000 4787 5411 2 chr3A.!!$F3 624

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
61 62 6.015434 GGACACAGATGTAAAAGACCCAAAAT 60.015 38.462 0.0 0.0 39.95 1.82 F
1573 2105 4.322080 TCCTACAACTATGCTCCATTCG 57.678 45.455 0.0 0.0 0.00 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3458 4262 4.855531 ACGCCACAAGCTTTAGTAAAAAG 58.144 39.130 0.0 0.0 40.39 2.27 R
4788 8221 1.338655 GCTTCCAAACGCACCCTTAAA 59.661 47.619 0.0 0.0 0.00 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 6.015434 GGACACAGATGTAAAAGACCCAAAAT 60.015 38.462 0.00 0.0 39.95 1.82
544 546 6.647895 GTCTCGGAATTGGTTTAGAGTACAAA 59.352 38.462 0.00 0.0 0.00 2.83
1573 2105 4.322080 TCCTACAACTATGCTCCATTCG 57.678 45.455 0.00 0.0 0.00 3.34
1702 2239 5.587043 CGGTGCTTTTAATGGGTTACTGATA 59.413 40.000 0.00 0.0 0.00 2.15
3602 4406 3.359950 ACCTGAGGGAGCATTGAATTTC 58.640 45.455 2.38 0.0 36.25 2.17
3772 7180 7.540400 CACATTATGCTTTTGTTTCATACCGAA 59.460 33.333 0.00 0.0 0.00 4.30
3849 7258 5.898174 ACTATTATGCAGTTGCTGTACGTA 58.102 37.500 5.62 0.0 42.66 3.57
5081 8575 6.123651 ACAACCTTCAGTACCATGTGTTAAA 58.876 36.000 0.00 0.0 0.00 1.52
5196 8794 4.901849 TGCCTATTAGTACAAGCTGATCCT 59.098 41.667 0.00 0.0 0.00 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 0.955905 GAACCACCGCCTGCTAAAAA 59.044 50.000 0.00 0.0 0.00 1.94
10 11 1.231958 CGAACCACCGCCTGCTAAAA 61.232 55.000 0.00 0.0 0.00 1.52
11 12 1.669760 CGAACCACCGCCTGCTAAA 60.670 57.895 0.00 0.0 0.00 1.85
12 13 2.047655 CGAACCACCGCCTGCTAA 60.048 61.111 0.00 0.0 0.00 3.09
13 14 2.992689 TCGAACCACCGCCTGCTA 60.993 61.111 0.00 0.0 0.00 3.49
14 15 4.379243 CTCGAACCACCGCCTGCT 62.379 66.667 0.00 0.0 0.00 4.24
15 16 2.775032 TAACTCGAACCACCGCCTGC 62.775 60.000 0.00 0.0 0.00 4.85
16 17 0.736325 CTAACTCGAACCACCGCCTG 60.736 60.000 0.00 0.0 0.00 4.85
17 18 1.590147 CTAACTCGAACCACCGCCT 59.410 57.895 0.00 0.0 0.00 5.52
18 19 1.447314 CCTAACTCGAACCACCGCC 60.447 63.158 0.00 0.0 0.00 6.13
19 20 1.447314 CCCTAACTCGAACCACCGC 60.447 63.158 0.00 0.0 0.00 5.68
20 21 0.108945 GTCCCTAACTCGAACCACCG 60.109 60.000 0.00 0.0 0.00 4.94
61 62 3.101437 TCTGGGCGACTGGTAGATTTTA 58.899 45.455 0.00 0.0 0.00 1.52
162 163 4.393155 CCGCTGTGGTGCTGCCTA 62.393 66.667 0.00 0.0 38.61 3.93
3458 4262 4.855531 ACGCCACAAGCTTTAGTAAAAAG 58.144 39.130 0.00 0.0 40.39 2.27
3849 7258 5.931724 CACCTTGTTCTTTTCACCAAACTTT 59.068 36.000 0.00 0.0 0.00 2.66
4788 8221 1.338655 GCTTCCAAACGCACCCTTAAA 59.661 47.619 0.00 0.0 0.00 1.52
5081 8575 9.265901 CTTGTAATCAATCAAAGACCGAGATAT 57.734 33.333 0.00 0.0 32.82 1.63
5196 8794 8.826710 GTTGTATGCATATTCAGCTACACTTAA 58.173 33.333 10.16 0.0 30.81 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.