Multiple sequence alignment - TraesCS4B01G181100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G181100 chr4B 100.000 2097 0 0 573 2669 396844850 396846946 0.000000e+00 3873
1 TraesCS4B01G181100 chr4B 87.649 502 41 6 761 1241 37919579 37919078 4.990000e-157 564
2 TraesCS4B01G181100 chr4B 97.423 194 5 0 573 766 634999154 634999347 5.510000e-87 331
3 TraesCS4B01G181100 chr4B 93.909 197 12 0 573 769 396854691 396854495 5.590000e-77 298
4 TraesCS4B01G181100 chr4B 100.000 143 0 0 1 143 396844278 396844420 5.670000e-67 265
5 TraesCS4B01G181100 chr4B 94.068 118 5 2 27 143 47032289 47032405 7.590000e-41 178
6 TraesCS4B01G181100 chr4B 94.737 114 6 0 30 143 628610500 628610387 7.590000e-41 178
7 TraesCS4B01G181100 chr7B 97.844 2087 43 2 583 2669 38663412 38665496 0.000000e+00 3603
8 TraesCS4B01G181100 chr7B 97.260 1788 46 3 882 2669 63651065 63649281 0.000000e+00 3027
9 TraesCS4B01G181100 chr7B 85.315 572 44 13 769 1319 630811576 630812128 3.000000e-154 555
10 TraesCS4B01G181100 chr7B 96.057 279 10 1 735 1013 147530395 147530118 1.130000e-123 453
11 TraesCS4B01G181100 chr1B 97.711 2097 45 2 573 2669 583966006 583963913 0.000000e+00 3603
12 TraesCS4B01G181100 chr1B 96.478 1789 60 3 882 2669 603765131 603763345 0.000000e+00 2952
13 TraesCS4B01G181100 chr1B 98.639 147 2 0 573 719 583956257 583956403 7.330000e-66 261
14 TraesCS4B01G181100 chr1B 94.737 114 6 0 30 143 93968381 93968494 7.590000e-41 178
15 TraesCS4B01G181100 chr1B 88.489 139 14 2 5 143 446715565 446715701 1.640000e-37 167
16 TraesCS4B01G181100 chr2B 97.473 2097 50 3 573 2669 111686951 111684858 0.000000e+00 3576
17 TraesCS4B01G181100 chr2B 96.758 1789 53 5 882 2669 70808659 70810443 0.000000e+00 2977
18 TraesCS4B01G181100 chr2B 97.001 1767 50 3 905 2669 165399505 165397740 0.000000e+00 2966
19 TraesCS4B01G181100 chr2B 97.409 193 5 0 574 766 111677717 111677909 1.980000e-86 329
20 TraesCS4B01G181100 chr2B 94.215 121 7 0 23 143 154847197 154847317 4.540000e-43 185
21 TraesCS4B01G181100 chr2B 95.495 111 5 0 33 143 111687225 111687115 7.590000e-41 178
22 TraesCS4B01G181100 chr6B 97.763 1788 38 2 882 2669 570994554 570992769 0.000000e+00 3079
23 TraesCS4B01G181100 chr6B 89.836 305 18 5 573 868 18858419 18858719 1.940000e-101 379
24 TraesCS4B01G181100 chr6B 93.162 117 8 0 27 143 687840831 687840947 3.530000e-39 172
25 TraesCS4B01G181100 chr5B 96.886 1766 51 4 905 2669 271903428 271905190 0.000000e+00 2953
26 TraesCS4B01G181100 chr5B 92.338 1253 58 15 573 1801 387148472 387149710 0.000000e+00 1748
27 TraesCS4B01G181100 chr3B 94.702 302 16 0 573 874 52703462 52703763 1.120000e-128 470
28 TraesCS4B01G181100 chr2A 97.222 216 6 0 573 788 2347130 2347345 1.510000e-97 366
29 TraesCS4B01G181100 chr6A 94.737 114 6 0 30 143 579417557 579417444 7.590000e-41 178
30 TraesCS4B01G181100 chr5A 94.737 114 6 0 30 143 705322830 705322717 7.590000e-41 178


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G181100 chr4B 396844278 396846946 2668 False 2069 3873 100.000 1 2669 2 chr4B.!!$F3 2668
1 TraesCS4B01G181100 chr4B 37919078 37919579 501 True 564 564 87.649 761 1241 1 chr4B.!!$R1 480
2 TraesCS4B01G181100 chr7B 38663412 38665496 2084 False 3603 3603 97.844 583 2669 1 chr7B.!!$F1 2086
3 TraesCS4B01G181100 chr7B 63649281 63651065 1784 True 3027 3027 97.260 882 2669 1 chr7B.!!$R1 1787
4 TraesCS4B01G181100 chr7B 630811576 630812128 552 False 555 555 85.315 769 1319 1 chr7B.!!$F2 550
5 TraesCS4B01G181100 chr1B 583963913 583966006 2093 True 3603 3603 97.711 573 2669 1 chr1B.!!$R1 2096
6 TraesCS4B01G181100 chr1B 603763345 603765131 1786 True 2952 2952 96.478 882 2669 1 chr1B.!!$R2 1787
7 TraesCS4B01G181100 chr2B 70808659 70810443 1784 False 2977 2977 96.758 882 2669 1 chr2B.!!$F1 1787
8 TraesCS4B01G181100 chr2B 165397740 165399505 1765 True 2966 2966 97.001 905 2669 1 chr2B.!!$R1 1764
9 TraesCS4B01G181100 chr2B 111684858 111687225 2367 True 1877 3576 96.484 33 2669 2 chr2B.!!$R2 2636
10 TraesCS4B01G181100 chr6B 570992769 570994554 1785 True 3079 3079 97.763 882 2669 1 chr6B.!!$R1 1787
11 TraesCS4B01G181100 chr5B 271903428 271905190 1762 False 2953 2953 96.886 905 2669 1 chr5B.!!$F1 1764
12 TraesCS4B01G181100 chr5B 387148472 387149710 1238 False 1748 1748 92.338 573 1801 1 chr5B.!!$F2 1228

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
96 97 0.325602 ACCCCTTGCGGACGAAATTA 59.674 50.0 0.0 0.0 0.0 1.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2016 2066 0.694771 AGGGCAAGAGTTCTGCATCA 59.305 50.0 0.0 0.0 0.0 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 0.325602 ACCCCTTGCGGACGAAATTA 59.674 50.000 0.00 0.00 0.00 1.40
123 124 3.569200 GACCCCCTCACAAGTGGCC 62.569 68.421 0.00 0.00 0.00 5.36
124 125 3.579302 CCCCCTCACAAGTGGCCA 61.579 66.667 0.00 0.00 0.00 5.36
1016 1058 1.812571 CGGTATGAGTTTGCCTTGCTT 59.187 47.619 0.00 0.00 0.00 3.91
1060 1102 6.585416 AGGAAAATGAAGAATGCAAGTTTGT 58.415 32.000 0.00 0.00 0.00 2.83
1100 1142 1.599518 GGTGTTGGTGTGGCGATCA 60.600 57.895 0.00 0.00 0.00 2.92
1320 1362 1.560923 CGCCTCTGTGCATGTACTAC 58.439 55.000 15.25 0.56 0.00 2.73
1339 1381 1.019278 CCGTTGGATTGACACGGAGG 61.019 60.000 3.87 0.00 45.77 4.30
1424 1466 2.530465 GAAGAGCGACGCGAGAAGGT 62.530 60.000 15.93 6.17 0.00 3.50
1582 1625 2.438614 CTCGTGAGGCGGAGAGGA 60.439 66.667 0.00 0.00 41.72 3.71
2016 2066 2.551721 GGCATCATCGTCATCCTCCATT 60.552 50.000 0.00 0.00 0.00 3.16
2206 2256 5.362717 TCGCTCTCCTCAGTCCATAAAAATA 59.637 40.000 0.00 0.00 0.00 1.40
2345 2395 3.446161 CCAGACCTACGTAATTGGTGAGA 59.554 47.826 9.53 0.00 36.45 3.27
2442 2492 2.107366 GCTAGCCTCAGAAGAGTCCTT 58.893 52.381 2.29 0.00 40.40 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 4.141274 TCTCTTTTGTCAATTCCAGTGGGA 60.141 41.667 9.92 0.00 43.03 4.37
96 97 1.850345 TGTGAGGGGGTCTCTTTTGTT 59.150 47.619 0.00 0.00 42.86 2.83
1016 1058 1.211703 TCGGCCTAATGCTTTGATCCA 59.788 47.619 0.00 0.00 40.92 3.41
1060 1102 2.607750 GACTGCCACCCCCAGAGA 60.608 66.667 0.00 0.00 34.47 3.10
1100 1142 1.425066 TCACCTCCTTCACCTTGCAAT 59.575 47.619 0.00 0.00 0.00 3.56
1186 1228 6.472808 GGCTTGTCGTACTCTGAAATAGTTAG 59.527 42.308 0.00 0.00 0.00 2.34
1189 1231 4.463186 AGGCTTGTCGTACTCTGAAATAGT 59.537 41.667 0.00 0.00 0.00 2.12
1424 1466 1.002888 CTGCTTTCTCCTCAGCTTCCA 59.997 52.381 0.00 0.00 36.92 3.53
1582 1625 4.068599 CGAGCCCTTTCTTTCTTTCTCTT 58.931 43.478 0.00 0.00 0.00 2.85
1908 1958 9.537852 TTAGTTTGTACTCTCTTATTGTAGGGA 57.462 33.333 0.00 0.00 35.78 4.20
2016 2066 0.694771 AGGGCAAGAGTTCTGCATCA 59.305 50.000 0.00 0.00 0.00 3.07
2206 2256 5.771666 TCAGAAGGACTGCAGAAAATCATTT 59.228 36.000 23.35 5.79 45.38 2.32
2345 2395 6.240894 AGTGACACCATAATGAATGAGTTGT 58.759 36.000 0.84 0.00 37.86 3.32
2442 2492 2.348472 AGTTTTCACCCTGGGATGAGA 58.652 47.619 22.23 11.63 0.00 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.