Multiple sequence alignment - TraesCS4B01G168200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G168200 chr4B 100.000 2582 0 0 1 2582 367928651 367926070 0.000000e+00 4769.0
1 TraesCS4B01G168200 chr4B 90.000 80 4 1 2471 2550 367926220 367926145 1.630000e-17 100.0
2 TraesCS4B01G168200 chr4B 87.640 89 5 6 2470 2553 136675343 136675256 5.880000e-17 99.0
3 TraesCS4B01G168200 chrUn 99.768 2582 6 0 1 2582 214476404 214473823 0.000000e+00 4735.0
4 TraesCS4B01G168200 chrUn 100.000 388 0 0 950 1337 480243844 480243457 0.000000e+00 717.0
5 TraesCS4B01G168200 chrUn 90.000 80 4 1 2471 2550 214473973 214473898 1.630000e-17 100.0
6 TraesCS4B01G168200 chr4D 94.249 2417 90 21 1 2385 297207648 297205249 0.000000e+00 3648.0
7 TraesCS4B01G168200 chr4A 92.926 1979 88 21 316 2261 191119113 191121072 0.000000e+00 2832.0
8 TraesCS4B01G168200 chr4A 90.691 333 18 6 1 320 191118506 191118838 5.100000e-117 431.0
9 TraesCS4B01G168200 chr4A 93.671 79 2 3 2433 2508 542983814 542983736 5.840000e-22 115.0
10 TraesCS4B01G168200 chr4A 91.139 79 6 1 2472 2550 542983814 542983737 3.510000e-19 106.0
11 TraesCS4B01G168200 chr6D 91.667 84 3 3 2425 2504 245495236 245495153 2.100000e-21 113.0
12 TraesCS4B01G168200 chr7D 91.463 82 4 3 2425 2504 446941208 446941288 2.720000e-20 110.0
13 TraesCS4B01G168200 chr6A 92.208 77 3 2 2433 2506 62810652 62810728 3.510000e-19 106.0
14 TraesCS4B01G168200 chr6A 92.105 76 5 1 2472 2547 62810652 62810726 3.510000e-19 106.0
15 TraesCS4B01G168200 chr6A 91.139 79 4 3 2433 2508 62810552 62810630 1.260000e-18 104.0
16 TraesCS4B01G168200 chr5D 88.750 80 9 0 2425 2504 361576845 361576924 5.880000e-17 99.0
17 TraesCS4B01G168200 chr3A 90.667 75 6 1 2473 2547 346745235 346745162 5.880000e-17 99.0
18 TraesCS4B01G168200 chr3A 87.805 82 5 3 2428 2504 695909757 695909676 9.840000e-15 91.6
19 TraesCS4B01G168200 chr3B 87.654 81 5 1 2425 2505 698618237 698618312 3.540000e-14 89.8
20 TraesCS4B01G168200 chr2A 97.143 35 1 0 2509 2543 26366934 26366968 2.770000e-05 60.2
21 TraesCS4B01G168200 chr5A 97.143 35 0 1 2504 2538 32670002 32669969 9.980000e-05 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G168200 chr4B 367926070 367928651 2581 True 2434.5 4769 95.0000 1 2582 2 chr4B.!!$R2 2581
1 TraesCS4B01G168200 chrUn 214473823 214476404 2581 True 2417.5 4735 94.8840 1 2582 2 chrUn.!!$R2 2581
2 TraesCS4B01G168200 chr4D 297205249 297207648 2399 True 3648.0 3648 94.2490 1 2385 1 chr4D.!!$R1 2384
3 TraesCS4B01G168200 chr4A 191118506 191121072 2566 False 1631.5 2832 91.8085 1 2261 2 chr4A.!!$F1 2260

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
948 1270 3.852536 GGTCGTAATCTCAAGACTTCACG 59.147 47.826 0.0 0.0 34.34 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2039 2364 2.649312 TGGTCTTCCTGATTTCCACCAT 59.351 45.455 0.0 0.0 34.23 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
948 1270 3.852536 GGTCGTAATCTCAAGACTTCACG 59.147 47.826 0.0 0.0 34.34 4.35
2039 2364 6.507958 TTCAGATTGCACCGAATTTTCATA 57.492 33.333 0.0 0.0 0.00 2.15
2357 2685 8.142485 ACTTTGGTACTTGCTACTAAGGATTA 57.858 34.615 0.0 0.0 30.19 1.75
2529 2857 9.352191 AGTAGCTCTCTCCGTAAAGAAATATAA 57.648 33.333 0.0 0.0 0.00 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
948 1270 2.825836 CCTTGATGGCCACGCTCC 60.826 66.667 8.16 0.00 0.00 4.70
1337 1660 1.462616 ACAAGTTGTGTGAAGCAGCA 58.537 45.000 7.96 0.00 39.72 4.41
2039 2364 2.649312 TGGTCTTCCTGATTTCCACCAT 59.351 45.455 0.00 0.00 34.23 3.55
2529 2857 9.395707 CTATAATAGTAGTGATCGAAACGCTTT 57.604 33.333 12.75 5.74 0.00 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.