Multiple sequence alignment - TraesCS4B01G161400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G161400 chr4B 100.000 2413 0 0 1 2413 316988460 316990872 0.000000e+00 4457
1 TraesCS4B01G161400 chr4B 98.632 2413 31 1 1 2413 146017872 146015462 0.000000e+00 4272
2 TraesCS4B01G161400 chr4B 89.157 996 89 8 3 991 83337699 83338682 0.000000e+00 1223
3 TraesCS4B01G161400 chr4B 95.010 501 17 2 499 991 253902440 253902940 0.000000e+00 780
4 TraesCS4B01G161400 chr4B 80.567 494 70 19 96 578 576194946 576195424 8.200000e-95 357
5 TraesCS4B01G161400 chr4B 85.124 121 16 2 1145 1264 279022006 279021887 3.260000e-24 122
6 TraesCS4B01G161400 chr7D 96.914 1426 39 3 989 2413 473872214 473870793 0.000000e+00 2385
7 TraesCS4B01G161400 chr5A 96.632 1425 45 2 989 2413 365327320 365328741 0.000000e+00 2362
8 TraesCS4B01G161400 chr5A 94.821 502 16 5 499 991 131733246 131733746 0.000000e+00 774
9 TraesCS4B01G161400 chr5A 94.286 455 15 4 499 944 129982956 129983408 0.000000e+00 686
10 TraesCS4B01G161400 chr5A 93.519 108 7 0 1 108 129980414 129980521 6.900000e-36 161
11 TraesCS4B01G161400 chr1A 96.375 1407 48 2 989 2394 424801661 424803065 0.000000e+00 2313
12 TraesCS4B01G161400 chr1A 94.632 503 16 5 499 991 267185511 267185010 0.000000e+00 769
13 TraesCS4B01G161400 chr3A 83.142 1394 148 43 1041 2413 302494803 302493476 0.000000e+00 1192
14 TraesCS4B01G161400 chr3A 94.821 502 16 4 499 991 171061060 171061560 0.000000e+00 774
15 TraesCS4B01G161400 chr3A 96.296 108 4 0 1 108 171048858 171048965 6.860000e-41 178
16 TraesCS4B01G161400 chr7B 83.614 1306 151 35 1145 2413 146357428 146356149 0.000000e+00 1168
17 TraesCS4B01G161400 chr7B 89.145 866 65 12 134 989 179639054 179638208 0.000000e+00 1051
18 TraesCS4B01G161400 chr7B 96.296 108 4 0 1 108 607343602 607343709 6.860000e-41 178
19 TraesCS4B01G161400 chr7B 94.444 108 6 0 1 108 607350271 607350378 1.480000e-37 167
20 TraesCS4B01G161400 chr6B 89.364 865 64 11 134 989 19453040 19453885 0.000000e+00 1062
21 TraesCS4B01G161400 chr6B 96.296 108 4 0 1 108 162220465 162220358 6.860000e-41 178
22 TraesCS4B01G161400 chr6A 84.211 1121 129 21 1145 2237 230684191 230683091 0.000000e+00 1046
23 TraesCS4B01G161400 chr6A 94.223 502 19 3 499 991 360132180 360131680 0.000000e+00 758
24 TraesCS4B01G161400 chr6A 94.444 108 6 0 1 108 360134717 360134610 1.480000e-37 167
25 TraesCS4B01G161400 chr3B 85.729 960 101 19 1041 1979 158633531 158634475 0.000000e+00 981
26 TraesCS4B01G161400 chr3B 84.252 762 87 13 1041 1786 678845618 678844874 0.000000e+00 712
27 TraesCS4B01G161400 chr3B 93.519 108 7 0 1 108 655492277 655492384 6.900000e-36 161
28 TraesCS4B01G161400 chr2B 88.186 838 55 21 164 991 663372751 663371948 0.000000e+00 959
29 TraesCS4B01G161400 chr7A 87.929 787 66 14 1652 2413 678119717 678120499 0.000000e+00 900
30 TraesCS4B01G161400 chr7A 94.223 502 19 3 499 991 541773176 541773676 0.000000e+00 758
31 TraesCS4B01G161400 chr7A 93.825 502 20 6 499 991 331645237 331645736 0.000000e+00 745
32 TraesCS4B01G161400 chr2A 95.219 502 14 4 499 991 192069298 192068798 0.000000e+00 785
33 TraesCS4B01G161400 chr4A 95.020 502 15 5 499 991 181374687 181374187 0.000000e+00 780
34 TraesCS4B01G161400 chr4A 80.718 529 72 17 65 578 7408366 7407853 3.760000e-103 385
35 TraesCS4B01G161400 chr5B 84.067 659 67 23 1784 2413 247445903 247445254 3.430000e-168 601
36 TraesCS4B01G161400 chr4D 83.300 497 58 11 96 578 461212646 461213131 3.680000e-118 435


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G161400 chr4B 316988460 316990872 2412 False 4457.0 4457 100.0000 1 2413 1 chr4B.!!$F3 2412
1 TraesCS4B01G161400 chr4B 146015462 146017872 2410 True 4272.0 4272 98.6320 1 2413 1 chr4B.!!$R1 2412
2 TraesCS4B01G161400 chr4B 83337699 83338682 983 False 1223.0 1223 89.1570 3 991 1 chr4B.!!$F1 988
3 TraesCS4B01G161400 chr4B 253902440 253902940 500 False 780.0 780 95.0100 499 991 1 chr4B.!!$F2 492
4 TraesCS4B01G161400 chr7D 473870793 473872214 1421 True 2385.0 2385 96.9140 989 2413 1 chr7D.!!$R1 1424
5 TraesCS4B01G161400 chr5A 365327320 365328741 1421 False 2362.0 2362 96.6320 989 2413 1 chr5A.!!$F2 1424
6 TraesCS4B01G161400 chr5A 131733246 131733746 500 False 774.0 774 94.8210 499 991 1 chr5A.!!$F1 492
7 TraesCS4B01G161400 chr5A 129980414 129983408 2994 False 423.5 686 93.9025 1 944 2 chr5A.!!$F3 943
8 TraesCS4B01G161400 chr1A 424801661 424803065 1404 False 2313.0 2313 96.3750 989 2394 1 chr1A.!!$F1 1405
9 TraesCS4B01G161400 chr1A 267185010 267185511 501 True 769.0 769 94.6320 499 991 1 chr1A.!!$R1 492
10 TraesCS4B01G161400 chr3A 302493476 302494803 1327 True 1192.0 1192 83.1420 1041 2413 1 chr3A.!!$R1 1372
11 TraesCS4B01G161400 chr3A 171061060 171061560 500 False 774.0 774 94.8210 499 991 1 chr3A.!!$F2 492
12 TraesCS4B01G161400 chr7B 146356149 146357428 1279 True 1168.0 1168 83.6140 1145 2413 1 chr7B.!!$R1 1268
13 TraesCS4B01G161400 chr7B 179638208 179639054 846 True 1051.0 1051 89.1450 134 989 1 chr7B.!!$R2 855
14 TraesCS4B01G161400 chr6B 19453040 19453885 845 False 1062.0 1062 89.3640 134 989 1 chr6B.!!$F1 855
15 TraesCS4B01G161400 chr6A 230683091 230684191 1100 True 1046.0 1046 84.2110 1145 2237 1 chr6A.!!$R1 1092
16 TraesCS4B01G161400 chr6A 360131680 360134717 3037 True 462.5 758 94.3335 1 991 2 chr6A.!!$R2 990
17 TraesCS4B01G161400 chr3B 158633531 158634475 944 False 981.0 981 85.7290 1041 1979 1 chr3B.!!$F1 938
18 TraesCS4B01G161400 chr3B 678844874 678845618 744 True 712.0 712 84.2520 1041 1786 1 chr3B.!!$R1 745
19 TraesCS4B01G161400 chr2B 663371948 663372751 803 True 959.0 959 88.1860 164 991 1 chr2B.!!$R1 827
20 TraesCS4B01G161400 chr7A 678119717 678120499 782 False 900.0 900 87.9290 1652 2413 1 chr7A.!!$F3 761
21 TraesCS4B01G161400 chr7A 541773176 541773676 500 False 758.0 758 94.2230 499 991 1 chr7A.!!$F2 492
22 TraesCS4B01G161400 chr2A 192068798 192069298 500 True 785.0 785 95.2190 499 991 1 chr2A.!!$R1 492
23 TraesCS4B01G161400 chr4A 181374187 181374687 500 True 780.0 780 95.0200 499 991 1 chr4A.!!$R2 492
24 TraesCS4B01G161400 chr4A 7407853 7408366 513 True 385.0 385 80.7180 65 578 1 chr4A.!!$R1 513
25 TraesCS4B01G161400 chr5B 247445254 247445903 649 True 601.0 601 84.0670 1784 2413 1 chr5B.!!$R1 629

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
344 497 1.007336 GTACGTCCACAACCTCAGCG 61.007 60.000 0.00 0.0 0.0 5.18 F
673 2998 3.461773 GCTGGAGGCGGCTGTAGA 61.462 66.667 19.63 0.0 0.0 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1218 3565 1.627834 CCTCTGGTTGCTTCTTCTCCT 59.372 52.381 0.0 0.0 0.0 3.69 R
1854 4207 2.305928 CATCCACCCGCCAAATGATAA 58.694 47.619 0.0 0.0 0.0 1.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 497 1.007336 GTACGTCCACAACCTCAGCG 61.007 60.000 0.00 0.00 0.00 5.18
391 549 3.579302 CCCCTTGCTCACCCCACA 61.579 66.667 0.00 0.00 0.00 4.17
673 2998 3.461773 GCTGGAGGCGGCTGTAGA 61.462 66.667 19.63 0.00 0.00 2.59
1160 3507 4.826733 ACACACACATGCATCTTTTCCTTA 59.173 37.500 0.00 0.00 0.00 2.69
1218 3565 1.561542 GGGGAAAGAGCAGAGGATTCA 59.438 52.381 0.00 0.00 0.00 2.57
1371 3719 2.620585 GCAAGGGATCTGTTCCTAATGC 59.379 50.000 4.85 8.74 44.75 3.56
1854 4207 5.900437 TGTTTATCCTACCCCTAGATCGAT 58.100 41.667 0.00 0.00 0.00 3.59
2237 4617 9.047947 ACTGGAAACCTACTAGACAGAATAAAT 57.952 33.333 0.00 0.00 0.00 1.40
2291 4675 9.638176 AGTTAATCAAGATGAATAGATTTGCCT 57.362 29.630 0.00 0.00 33.22 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
344 497 1.759459 CGGAGGGGGAACTCATAGCC 61.759 65.000 0.00 0.0 39.27 3.93
673 2998 5.498393 TCAGTAGTCAGATAAGTCGACCTT 58.502 41.667 13.01 8.6 37.17 3.50
1160 3507 3.507162 TCACAACACAACATCAGGGAT 57.493 42.857 0.00 0.0 0.00 3.85
1218 3565 1.627834 CCTCTGGTTGCTTCTTCTCCT 59.372 52.381 0.00 0.0 0.00 3.69
1371 3719 3.819902 CCCATCCAAACCAACAAAAATGG 59.180 43.478 0.00 0.0 43.84 3.16
1854 4207 2.305928 CATCCACCCGCCAAATGATAA 58.694 47.619 0.00 0.0 0.00 1.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.