Multiple sequence alignment - TraesCS4B01G147600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G147600 chr4B 100.000 2645 0 0 1 2645 209306367 209303723 0 4885
1 TraesCS4B01G147600 chr1A 98.488 2646 37 2 1 2645 498684524 498687167 0 4662
2 TraesCS4B01G147600 chrUn 98.411 2644 40 2 1 2642 186201714 186204357 0 4649
3 TraesCS4B01G147600 chr7B 98.376 2647 41 2 1 2645 742996152 742993506 0 4649
4 TraesCS4B01G147600 chr7B 98.224 2647 44 3 1 2645 716872075 716874720 0 4625
5 TraesCS4B01G147600 chr5A 97.998 2647 51 2 1 2645 492862434 492859788 0 4593
6 TraesCS4B01G147600 chr4A 97.810 2648 54 4 1 2645 67603673 67601027 0 4566
7 TraesCS4B01G147600 chr2B 97.809 2647 56 2 1 2645 391167715 391165069 0 4566
8 TraesCS4B01G147600 chr2B 97.771 2647 54 4 1 2645 112847906 112845263 0 4556
9 TraesCS4B01G147600 chr2B 97.242 2611 69 3 1 2608 357518482 357521092 0 4420


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G147600 chr4B 209303723 209306367 2644 True 4885 4885 100.000 1 2645 1 chr4B.!!$R1 2644
1 TraesCS4B01G147600 chr1A 498684524 498687167 2643 False 4662 4662 98.488 1 2645 1 chr1A.!!$F1 2644
2 TraesCS4B01G147600 chrUn 186201714 186204357 2643 False 4649 4649 98.411 1 2642 1 chrUn.!!$F1 2641
3 TraesCS4B01G147600 chr7B 742993506 742996152 2646 True 4649 4649 98.376 1 2645 1 chr7B.!!$R1 2644
4 TraesCS4B01G147600 chr7B 716872075 716874720 2645 False 4625 4625 98.224 1 2645 1 chr7B.!!$F1 2644
5 TraesCS4B01G147600 chr5A 492859788 492862434 2646 True 4593 4593 97.998 1 2645 1 chr5A.!!$R1 2644
6 TraesCS4B01G147600 chr4A 67601027 67603673 2646 True 4566 4566 97.810 1 2645 1 chr4A.!!$R1 2644
7 TraesCS4B01G147600 chr2B 391165069 391167715 2646 True 4566 4566 97.809 1 2645 1 chr2B.!!$R2 2644
8 TraesCS4B01G147600 chr2B 112845263 112847906 2643 True 4556 4556 97.771 1 2645 1 chr2B.!!$R1 2644
9 TraesCS4B01G147600 chr2B 357518482 357521092 2610 False 4420 4420 97.242 1 2608 1 chr2B.!!$F1 2607

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
323 325 1.150536 GGCTTCCAACCTGACACCA 59.849 57.895 0.0 0.0 0.0 4.17 F
963 966 5.803237 AAACTAGCACTACTAACACAGGT 57.197 39.130 0.0 0.0 0.0 4.00 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1286 1290 2.149578 AGAGTGAGTTGCTGTCAATGC 58.850 47.619 0.00 0.0 34.29 3.56 R
1848 1853 2.263077 CAGCGATCGAGCAACTAAACT 58.737 47.619 21.57 0.0 40.15 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 7.555554 ACAGTAACTAGAATTAGAAGTCGGCTA 59.444 37.037 0.00 0.0 0.00 3.93
116 117 1.747709 CAGCAGCAAGGCTATGTCTT 58.252 50.000 0.00 0.0 43.68 3.01
200 202 3.589951 AGCCAGTGCCATCATTAGAAT 57.410 42.857 0.00 0.0 38.69 2.40
223 225 1.818674 CCGGCCATTTTAGTTTCAGCT 59.181 47.619 2.24 0.0 0.00 4.24
257 259 2.240921 GGCAAGGAGGAAAGGAAGAGAT 59.759 50.000 0.00 0.0 0.00 2.75
297 299 1.257743 TGAGGCGCTAGAACAGACTT 58.742 50.000 7.64 0.0 0.00 3.01
323 325 1.150536 GGCTTCCAACCTGACACCA 59.849 57.895 0.00 0.0 0.00 4.17
820 823 6.672147 ACGATTTCTTCTTTCATTTCCACTG 58.328 36.000 0.00 0.0 0.00 3.66
963 966 5.803237 AAACTAGCACTACTAACACAGGT 57.197 39.130 0.00 0.0 0.00 4.00
1445 1450 1.611491 GGCCAAACGAATCCAAGACAA 59.389 47.619 0.00 0.0 0.00 3.18
1593 1598 1.452025 CACTTCGTTCGCTGTGTACTG 59.548 52.381 0.00 0.0 0.00 2.74
1783 1788 5.068198 TCGGGTTAGTTCACGCTAGATTATT 59.932 40.000 0.00 0.0 33.94 1.40
1848 1853 8.450964 CAAAAGATTTCTATTTGGAGTTCGCTA 58.549 33.333 0.00 0.0 31.93 4.26
2094 2099 3.192922 CGGGGCCGATGTTTCGTC 61.193 66.667 0.00 0.0 43.97 4.20
2271 2276 4.099419 ACGTCATGCTAGGAATGTATCACA 59.901 41.667 0.00 0.0 0.00 3.58
2295 2300 2.104622 CCCATGCAAACCAAAGGAAAGT 59.895 45.455 0.00 0.0 0.00 2.66
2301 2306 7.147846 CCATGCAAACCAAAGGAAAGTAGATAT 60.148 37.037 0.00 0.0 0.00 1.63
2427 2432 1.218316 GGTCGGAAGCTGGTCGATT 59.782 57.895 9.04 0.0 35.35 3.34
2465 2470 2.297701 CACAACACCTTTGCTAGTGGT 58.702 47.619 0.00 0.0 38.34 4.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 1.001633 GCCCCTGTCGAACTTTGACTA 59.998 52.381 10.05 0.00 37.26 2.59
200 202 2.817258 CTGAAACTAAAATGGCCGGACA 59.183 45.455 15.46 15.46 0.00 4.02
223 225 3.263425 CCTCCTTGCCCTAACTTGAACTA 59.737 47.826 0.00 0.00 0.00 2.24
257 259 7.416664 GCCTCATTCTTTACATCCTTGCATTAA 60.417 37.037 0.00 0.00 0.00 1.40
323 325 5.365619 TCCTCTTTCGAAAAGTAGCAAAGT 58.634 37.500 12.41 0.00 0.00 2.66
638 641 5.015515 GGGCGTAACTCCCTATAGTATTCT 58.984 45.833 0.00 0.00 40.66 2.40
647 650 3.317455 TCTTATGGGCGTAACTCCCTA 57.683 47.619 3.60 0.00 44.23 3.53
1286 1290 2.149578 AGAGTGAGTTGCTGTCAATGC 58.850 47.619 0.00 0.00 34.29 3.56
1593 1598 5.037385 GTCAAAAGACAAGCAAGTCCTTTC 58.963 41.667 5.09 0.00 39.34 2.62
1783 1788 5.284861 TCTAACAGGTGTTACAAGCTTCA 57.715 39.130 0.00 0.00 39.31 3.02
1848 1853 2.263077 CAGCGATCGAGCAACTAAACT 58.737 47.619 21.57 0.00 40.15 2.66
2094 2099 2.556840 ATCCGATGGCCACCCACAAG 62.557 60.000 8.16 0.00 45.77 3.16
2465 2470 7.412129 CGCATAGTACGAAAACCAACAGAAATA 60.412 37.037 0.00 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.