Multiple sequence alignment - TraesCS4B01G147000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G147000 chr4B 100.000 2753 0 0 1 2753 209271128 209268376 0.000000e+00 5084
1 TraesCS4B01G147000 chr7B 98.548 2754 38 2 1 2752 743006244 743008997 0.000000e+00 4863
2 TraesCS4B01G147000 chrUn 98.512 2756 37 3 1 2753 186191234 186188480 0.000000e+00 4859
3 TraesCS4B01G147000 chrUn 98.748 2636 30 3 120 2753 86478354 86480988 0.000000e+00 4682
4 TraesCS4B01G147000 chr7D 98.403 2756 36 4 1 2753 579029918 579032668 0.000000e+00 4839
5 TraesCS4B01G147000 chr7A 97.895 2755 52 3 1 2753 120880631 120883381 0.000000e+00 4761
6 TraesCS4B01G147000 chr6D 97.495 2755 63 5 1 2753 369917825 369915075 0.000000e+00 4700
7 TraesCS4B01G147000 chr6D 97.458 2754 66 4 1 2753 283153939 283151189 0.000000e+00 4695
8 TraesCS4B01G147000 chr1D 97.974 2715 43 9 42 2753 212467639 212464934 0.000000e+00 4698
9 TraesCS4B01G147000 chr1A 98.597 2637 34 2 120 2753 112004608 112001972 0.000000e+00 4662
10 TraesCS4B01G147000 chr3B 91.304 138 4 3 1 138 730161725 730161854 6.060000e-42 182
11 TraesCS4B01G147000 chr2B 95.690 116 0 3 1 116 357307210 357307320 6.060000e-42 182


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G147000 chr4B 209268376 209271128 2752 True 5084 5084 100.000 1 2753 1 chr4B.!!$R1 2752
1 TraesCS4B01G147000 chr7B 743006244 743008997 2753 False 4863 4863 98.548 1 2752 1 chr7B.!!$F1 2751
2 TraesCS4B01G147000 chrUn 186188480 186191234 2754 True 4859 4859 98.512 1 2753 1 chrUn.!!$R1 2752
3 TraesCS4B01G147000 chrUn 86478354 86480988 2634 False 4682 4682 98.748 120 2753 1 chrUn.!!$F1 2633
4 TraesCS4B01G147000 chr7D 579029918 579032668 2750 False 4839 4839 98.403 1 2753 1 chr7D.!!$F1 2752
5 TraesCS4B01G147000 chr7A 120880631 120883381 2750 False 4761 4761 97.895 1 2753 1 chr7A.!!$F1 2752
6 TraesCS4B01G147000 chr6D 369915075 369917825 2750 True 4700 4700 97.495 1 2753 1 chr6D.!!$R2 2752
7 TraesCS4B01G147000 chr6D 283151189 283153939 2750 True 4695 4695 97.458 1 2753 1 chr6D.!!$R1 2752
8 TraesCS4B01G147000 chr1D 212464934 212467639 2705 True 4698 4698 97.974 42 2753 1 chr1D.!!$R1 2711
9 TraesCS4B01G147000 chr1A 112001972 112004608 2636 True 4662 4662 98.597 120 2753 1 chr1A.!!$R1 2633

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
813 818 0.1023 GCGGGGGCAATTACAATGTC 59.898 55.0 0.0 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2271 2282 1.373435 CGGCAAGTACCCTCAACCA 59.627 57.895 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 138 3.395941 TCTTTCTTTTCTCTTCCAGCCCT 59.604 43.478 0.00 0.0 0.00 5.19
249 254 5.201243 TGGGACTCTCTATTTCATCTTCGA 58.799 41.667 0.00 0.0 0.00 3.71
309 314 4.899502 CTGATTCGTATGGAATTAGCCCT 58.100 43.478 1.85 0.0 45.33 5.19
813 818 0.102300 GCGGGGGCAATTACAATGTC 59.898 55.000 0.00 0.0 0.00 3.06
913 919 1.646189 GTTCTTCGGTCATCCAGAGC 58.354 55.000 0.00 0.0 41.32 4.09
1327 1333 6.751888 GGTTGCACATTTCCATTATGTACTTC 59.248 38.462 0.00 0.0 34.59 3.01
1340 1346 0.680061 GTACTTCCTATGGGAGCCGG 59.320 60.000 0.00 0.0 43.29 6.13
1357 1363 3.257127 AGCCGGTTTTGCTTTATTTGCTA 59.743 39.130 1.90 0.0 34.87 3.49
1566 1572 7.952671 TGAGCAGTTTCGGTTCTTATATATCT 58.047 34.615 0.00 0.0 0.00 1.98
1614 1620 2.549754 AGTTGTCGCAATCACTTCAAGG 59.450 45.455 0.00 0.0 0.00 3.61
1617 1623 1.734465 GTCGCAATCACTTCAAGGAGG 59.266 52.381 0.00 0.0 0.00 4.30
1717 1723 3.371166 CCCTCCGGCCTTTCATACTTTTA 60.371 47.826 0.00 0.0 0.00 1.52
2033 2044 4.989277 AGGCAAGGCATATTCATATGTCA 58.011 39.130 12.78 0.0 45.38 3.58
2118 2129 0.392998 GGACCAAGGATGCGATGTGT 60.393 55.000 0.00 0.0 0.00 3.72
2271 2282 4.467198 AGATTCATTCCTTCGTTACGGT 57.533 40.909 4.53 0.0 0.00 4.83
2367 2378 1.598130 GCACCCCGATCATACCAGC 60.598 63.158 0.00 0.0 0.00 4.85
2375 2386 1.498865 GATCATACCAGCCGCAACCG 61.499 60.000 0.00 0.0 0.00 4.44
2565 2576 2.418669 GGAGGAACCTATGGGAATGGA 58.581 52.381 0.25 0.0 36.25 3.41
2733 2744 3.746045 AGGTGACGTTTTAGCTCTTCA 57.254 42.857 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 8.862091 TTTCTAATTCCCTTCTAAGATCCTCT 57.138 34.615 0.00 0.0 0.00 3.69
133 138 0.837272 CTTATCAAAGAGGGGCCGGA 59.163 55.000 5.05 0.0 34.37 5.14
309 314 2.285083 CAAGAATTTGATCGCCGGGTA 58.715 47.619 2.18 0.0 36.36 3.69
813 818 9.976255 TTGTATTAAAGTTTCGATCGGTTAATG 57.024 29.630 16.41 0.0 0.00 1.90
913 919 6.106648 TCCAGGCAGAATGAGAATATACAG 57.893 41.667 0.00 0.0 39.69 2.74
1327 1333 1.384222 GCAAAACCGGCTCCCATAGG 61.384 60.000 0.00 0.0 0.00 2.57
1566 1572 3.006110 AGAAACGACGAATCCCAACTACA 59.994 43.478 0.00 0.0 0.00 2.74
1614 1620 4.631131 CACATTTTTGGTTCTTTCCCCTC 58.369 43.478 0.00 0.0 0.00 4.30
1617 1623 2.799978 CGCACATTTTTGGTTCTTTCCC 59.200 45.455 0.00 0.0 0.00 3.97
2000 2011 8.166061 TGAATATGCCTTGCCTAGAAGATAAAT 58.834 33.333 0.00 0.0 0.00 1.40
2010 2021 6.125589 TGACATATGAATATGCCTTGCCTA 57.874 37.500 10.38 0.0 42.98 3.93
2033 2044 1.705745 GGAGACACTTCCCCCTTCTTT 59.294 52.381 0.00 0.0 0.00 2.52
2118 2129 1.376543 CTACTCCGACCTACGCTTCA 58.623 55.000 0.00 0.0 41.07 3.02
2271 2282 1.373435 CGGCAAGTACCCTCAACCA 59.627 57.895 0.00 0.0 0.00 3.67
2367 2378 1.593196 ATACAATGATCCGGTTGCGG 58.407 50.000 0.00 0.0 0.00 5.69
2565 2576 6.412362 ACTAATAATCTCGATGCAGGACTT 57.588 37.500 0.00 0.0 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.