Multiple sequence alignment - TraesCS4B01G146300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4B01G146300 chr4B 100.000 2849 0 0 1 2849 209112118 209114966 0 5262
1 TraesCS4B01G146300 chr6A 98.353 2853 43 1 1 2849 84403955 84401103 0 5005
2 TraesCS4B01G146300 chr1B 98.281 2851 46 2 1 2849 619189739 619186890 0 4990
3 TraesCS4B01G146300 chr5D 98.214 2855 44 4 1 2849 503225673 503222820 0 4983
4 TraesCS4B01G146300 chr2B 98.179 2855 45 3 1 2849 449213741 449210888 0 4977
5 TraesCS4B01G146300 chr2B 98.037 2853 46 3 1 2849 234535565 234532719 0 4950
6 TraesCS4B01G146300 chr2B 97.687 2854 59 4 1 2849 474915895 474913044 0 4898
7 TraesCS4B01G146300 chr3B 98.070 2850 53 2 1 2849 6005174 6002326 0 4957
8 TraesCS4B01G146300 chr3B 98.001 2851 55 1 1 2849 92291152 92288302 0 4948
9 TraesCS4B01G146300 chr3A 98.039 2855 49 4 1 2849 66010168 66013021 0 4955


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4B01G146300 chr4B 209112118 209114966 2848 False 5262 5262 100.000 1 2849 1 chr4B.!!$F1 2848
1 TraesCS4B01G146300 chr6A 84401103 84403955 2852 True 5005 5005 98.353 1 2849 1 chr6A.!!$R1 2848
2 TraesCS4B01G146300 chr1B 619186890 619189739 2849 True 4990 4990 98.281 1 2849 1 chr1B.!!$R1 2848
3 TraesCS4B01G146300 chr5D 503222820 503225673 2853 True 4983 4983 98.214 1 2849 1 chr5D.!!$R1 2848
4 TraesCS4B01G146300 chr2B 449210888 449213741 2853 True 4977 4977 98.179 1 2849 1 chr2B.!!$R2 2848
5 TraesCS4B01G146300 chr2B 234532719 234535565 2846 True 4950 4950 98.037 1 2849 1 chr2B.!!$R1 2848
6 TraesCS4B01G146300 chr2B 474913044 474915895 2851 True 4898 4898 97.687 1 2849 1 chr2B.!!$R3 2848
7 TraesCS4B01G146300 chr3B 6002326 6005174 2848 True 4957 4957 98.070 1 2849 1 chr3B.!!$R1 2848
8 TraesCS4B01G146300 chr3B 92288302 92291152 2850 True 4948 4948 98.001 1 2849 1 chr3B.!!$R2 2848
9 TraesCS4B01G146300 chr3A 66010168 66013021 2853 False 4955 4955 98.039 1 2849 1 chr3A.!!$F1 2848

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
568 576 0.251341 AAGCATCCCAAAAGCGTCCT 60.251 50.000 0.0 0.0 0.00 3.85 F
652 660 1.067915 GCCATACGCAAAAAGGAAGCA 60.068 47.619 0.0 0.0 37.47 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1716 1725 2.884320 GGGGAAAGCTTAAACCCAAGA 58.116 47.619 26.54 0.0 43.67 3.02 R
2110 2119 3.179443 TGTCAACGGATGCTCCTATTC 57.821 47.619 0.00 0.0 33.30 1.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 7.210873 AGTAAACAGAATTCCATACTCGATCC 58.789 38.462 0.65 0.00 0.00 3.36
89 90 3.410631 TTCTGTGGAAAGCCGTATTCA 57.589 42.857 0.00 0.00 36.79 2.57
127 128 1.843206 GGCTTGGAGGGAGATCTTTCT 59.157 52.381 0.00 0.00 33.88 2.52
219 225 6.465439 AAAGAAAACGGATTCTTGAACCTT 57.535 33.333 15.61 0.48 46.25 3.50
237 243 2.290367 CCTTTTTCACGCTCATGTCACA 59.710 45.455 0.00 0.00 0.00 3.58
381 389 3.040147 TCGAGCCGTGAAAAAGATTCT 57.960 42.857 0.00 0.00 0.00 2.40
409 417 9.185192 CAAAAGACAGAAACAAATCCACTATTC 57.815 33.333 0.00 0.00 0.00 1.75
568 576 0.251341 AAGCATCCCAAAAGCGTCCT 60.251 50.000 0.00 0.00 0.00 3.85
652 660 1.067915 GCCATACGCAAAAAGGAAGCA 60.068 47.619 0.00 0.00 37.47 3.91
711 719 6.364706 GCACATTTTCGTTAATCCATGAACAA 59.635 34.615 0.00 0.00 0.00 2.83
1026 1034 6.433716 TGATCTGGCATGTACAGAATGAAAAA 59.566 34.615 20.81 2.38 46.89 1.94
1153 1161 7.555965 TCTTATTCTTCTGATCGATTCAACCA 58.444 34.615 0.00 0.00 32.78 3.67
1381 1389 8.800370 TGAATGTACAGAAATGGCTATAACAA 57.200 30.769 0.33 0.00 0.00 2.83
1510 1518 6.500336 TCCTACCTATTGTCTGGATATACCC 58.500 44.000 0.00 0.00 38.00 3.69
1583 1591 2.570135 GGCAAGCTCTTCTATTCTGGG 58.430 52.381 0.00 0.00 0.00 4.45
1695 1704 3.102204 CTCCCAAGGAATTTCCATTGCT 58.898 45.455 17.57 0.00 42.60 3.91
1716 1725 6.077993 TGCTCTTATATCCATCACTGTAGGT 58.922 40.000 0.00 0.00 0.00 3.08
2110 2119 2.712709 TCCTTCAGAGACTACGAGTGG 58.287 52.381 0.00 0.00 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 7.621285 TCCACAGAATTCTATAGGGATCTATGG 59.379 40.741 7.86 15.23 36.87 2.74
174 180 9.143155 TCTTTTTCTAAGGGCTAAAATCACTTT 57.857 29.630 0.00 0.00 0.00 2.66
219 225 2.157474 CGATGTGACATGAGCGTGAAAA 59.843 45.455 1.23 0.00 0.00 2.29
381 389 7.639113 AGTGGATTTGTTTCTGTCTTTTGTA 57.361 32.000 0.00 0.00 0.00 2.41
548 556 0.603065 GGACGCTTTTGGGATGCTTT 59.397 50.000 0.00 0.00 36.14 3.51
568 576 5.913137 ATTTGAAAGCCATATTTCGACCA 57.087 34.783 0.00 0.00 41.21 4.02
652 660 2.507058 TGCCTCTGCCATTCTATGAGTT 59.493 45.455 0.00 0.00 36.33 3.01
711 719 9.935241 GATCCATGTGTCTACATACATAGATTT 57.065 33.333 0.00 0.00 45.53 2.17
1132 1140 5.583854 CAGTGGTTGAATCGATCAGAAGAAT 59.416 40.000 0.00 0.00 39.77 2.40
1153 1161 6.784031 ACCAAGGTCTATCTTTTTGATCAGT 58.216 36.000 0.00 0.00 36.65 3.41
1405 1413 7.184022 ACATAAAAACATTCCCCCTAGAGTAGT 59.816 37.037 0.00 0.00 0.00 2.73
1510 1518 5.411361 CCTCATTAGACCGTAGATCTCTCTG 59.589 48.000 0.00 0.00 32.66 3.35
1583 1591 5.471456 CCATATAGCCAAGAGAAACCATGAC 59.529 44.000 0.00 0.00 0.00 3.06
1679 1688 8.006564 TGGATATAAGAGCAATGGAAATTCCTT 58.993 33.333 13.78 3.91 37.46 3.36
1695 1704 7.233553 CCAAGACCTACAGTGATGGATATAAGA 59.766 40.741 11.86 0.00 34.19 2.10
1716 1725 2.884320 GGGGAAAGCTTAAACCCAAGA 58.116 47.619 26.54 0.00 43.67 3.02
1984 1993 7.260722 GTAATAACGAACTTGCAAAATGGAC 57.739 36.000 0.00 0.00 0.00 4.02
2110 2119 3.179443 TGTCAACGGATGCTCCTATTC 57.821 47.619 0.00 0.00 33.30 1.75
2586 2603 4.305539 TTCCAGAAGAAGATGCCATTCA 57.694 40.909 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.